Mutagenetix > Incidental Mutation

Incidental Mutation 'R6142:Cc2d2a'

488618

Institutional Source

Beutler Lab

Gene Symbol

Cc2d2a

Ensembl Gene

ENSMUSG00000039765

Gene Name

coiled-coil and C2 domain containing 2A

Synonyms

b2b1035Clo, 5730509K17Rik

MMRRC Submission

044289-MU

Accession Numbers

Genbank: NM_172274; MGI: 1924487

Essential gene?

Probably essential (E-score: 0.900) question?

Stock #

R6142 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43662346-43740972 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 43703198 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 490 (V490F)

Ref Sequence

ENSEMBL: ENSMUSP00000114349 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]

AlphaFold

Q8CFW7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048150
AA Change: V539F

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: V539F

Domain	Start	End	E-Value	Type
low complexity region	26	41	N/A	INTRINSIC
low complexity region	58	67	N/A	INTRINSIC
low complexity region	124	136	N/A	INTRINSIC
low complexity region	203	217	N/A	INTRINSIC
coiled coil region	472	501	N/A	INTRINSIC
coiled coil region	553	582	N/A	INTRINSIC
Pfam:CC2D2AN-C2	645	817	2e-36	PFAM
low complexity region	1005	1017	N/A	INTRINSIC
low complexity region	1024	1036	N/A	INTRINSIC
C2	1048	1208	3.43e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000125866
AA Change: V490F

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765
AA Change: V490F

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	154	168	N/A	INTRINSIC
coiled coil region	423	452	N/A	INTRINSIC
coiled coil region	504	533	N/A	INTRINSIC
Pfam:CC2D2AN-C2	596	768	7.7e-44	PFAM
low complexity region	970	982	N/A	INTRINSIC
C2	994	1154	2.3e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127355

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 94.2%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy6	T	C	15: 98,598,422	M579V	probably benign	Het
Agtr1b	T	C	3: 20,316,394	D16G	probably benign	Het
Akap12	C	A	10: 4,313,740		probably null	Het
Alpk2	T	C	18: 65,305,385	E979G	possibly damaging	Het
Arfgap3	T	C	15: 83,350,127	D8G	probably damaging	Het
AW551984	G	T	9: 39,597,114	L369I	probably benign	Het
Bmp8b	A	T	4: 123,115,250	H207L	probably benign	Het
Cnot6l	C	T	5: 96,082,978	V377I	probably benign	Het
Col25a1	T	A	3: 130,583,329		probably benign	Het
Crocc2	C	G	1: 93,190,479	Q375E	possibly damaging	Het
Ganc	T	C	2: 120,430,737		probably null	Het
Gm28168	C	A	1: 117,947,948	D102E	probably benign	Het
Gm8212	T	C	14: 44,201,227		probably null	Het
Gria2	T	C	3: 80,801,717	T53A	probably benign	Het
Hipk4	G	A	7: 27,529,165	V347M	probably damaging	Het
Hmgxb3	T	C	18: 61,136,237	E991G	probably benign	Het
Hyal1	G	A	9: 107,579,374	R420H	probably benign	Het
Il5	G	A	11: 53,720,978		probably null	Het
Kcnh7	T	C	2: 62,739,360	I731V	possibly damaging	Het
Lamb2	A	T	9: 108,485,618	K759*	probably null	Het
Lnpep	A	G	17: 17,566,681		probably null	Het
Lrch1	T	C	14: 74,947,500	E54G	probably damaging	Het
Msl3l2	A	G	10: 56,115,365	D62G	possibly damaging	Het
Mslnl	T	C	17: 25,744,557	L339P	probably damaging	Het
Nfe2l2	T	C	2: 75,679,417	I20V	probably damaging	Het
Pgm5	A	C	19: 24,824,408	I152S	probably damaging	Het
Plcg2	C	A	8: 117,585,271	T434K	probably benign	Het
Prrc2c	T	C	1: 162,710,387	E558G	unknown	Het
Ranbp3	T	C	17: 56,686,018	V12A	probably benign	Het
Rgsl1	A	G	1: 153,812,238	V635A	probably benign	Het
Rpap2	T	C	5: 107,598,298	V14A	probably benign	Het
Rxrg	G	T	1: 167,632,622	A341S	possibly damaging	Het
Sbf2	A	G	7: 110,348,975	S1177P	probably damaging	Het
Sema6a	T	C	18: 47,281,199	T498A	probably benign	Het
Slc13a4	G	A	6: 35,301,783	A57V	probably damaging	Het
Slc6a3	A	T	13: 73,544,783	D174V	probably benign	Het
Spg20	T	G	3: 55,117,248	V88G	probably damaging	Het
Tanc1	A	T	2: 59,833,222	R1108*	probably null	Het
Tas2r140	C	T	6: 133,055,735	G20E	probably damaging	Het
Tdrd6	A	G	17: 43,629,482	V225A	probably benign	Het
Tmem168	C	A	6: 13,591,369	A99S	probably benign	Het
Tnk2	T	A	16: 32,670,099	D252E	probably damaging	Het
Tpsg1	A	T	17: 25,372,486	H20L	probably benign	Het
Tram1l1	T	C	3: 124,321,443	F84S	probably damaging	Het
Vmn2r12	T	A	5: 109,092,897	I117L	probably benign	Het
Zfp148	T	C	16: 33,495,459	L219S	possibly damaging	Het
Zfp40	C	A	17: 23,176,337	E425D	probably benign	Het
Zfp773	T	C	7: 7,132,482	T372A	probably benign	Het

Other mutations in Cc2d2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Cc2d2a	APN	5	43724380	splice site	probably benign
IGL00937:Cc2d2a	APN	5	43688122	critical splice acceptor site	probably null
IGL01322:Cc2d2a	APN	5	43689003	missense	probably benign	0.00
IGL01349:Cc2d2a	APN	5	43723784	missense	probably benign	0.01
IGL01448:Cc2d2a	APN	5	43684185	missense	possibly damaging	0.65
IGL01871:Cc2d2a	APN	5	43688969	missense	probably damaging	0.98
IGL01947:Cc2d2a	APN	5	43688237	missense	probably damaging	0.96
IGL01976:Cc2d2a	APN	5	43683115	missense	probably benign	0.02
IGL02113:Cc2d2a	APN	5	43685248	splice site	probably null
IGL02364:Cc2d2a	APN	5	43735450	missense	probably damaging	1.00
IGL02448:Cc2d2a	APN	5	43683205	splice site	probably benign
IGL02458:Cc2d2a	APN	5	43718554	missense	probably benign	0.01
IGL02542:Cc2d2a	APN	5	43688910	splice site	probably benign
IGL02834:Cc2d2a	APN	5	43714521	nonsense	probably null
IGL02940:Cc2d2a	APN	5	43728294	splice site	probably null
IGL03003:Cc2d2a	APN	5	43671266	missense	probably benign	0.22
IGL03183:Cc2d2a	APN	5	43732379	missense	probably damaging	1.00
C9142:Cc2d2a	UTSW	5	43735457	splice site	probably benign
P0028:Cc2d2a	UTSW	5	43684199	missense	probably benign
R0193:Cc2d2a	UTSW	5	43736118	missense	probably damaging	1.00
R0201:Cc2d2a	UTSW	5	43737512	missense	probably damaging	1.00
R0211:Cc2d2a	UTSW	5	43688266	splice site	probably null
R0243:Cc2d2a	UTSW	5	43696638	splice site	probably benign
R0317:Cc2d2a	UTSW	5	43706901	critical splice donor site	probably null
R0453:Cc2d2a	UTSW	5	43703294	missense	probably benign	0.00
R0558:Cc2d2a	UTSW	5	43724387	splice site	probably benign
R0624:Cc2d2a	UTSW	5	43730029	missense	probably benign
R0634:Cc2d2a	UTSW	5	43681381	splice site	probably benign
R1503:Cc2d2a	UTSW	5	43695239	missense	probably damaging	1.00
R1635:Cc2d2a	UTSW	5	43722470	missense	probably damaging	1.00
R1686:Cc2d2a	UTSW	5	43739371	missense	possibly damaging	0.81
R1707:Cc2d2a	UTSW	5	43723688	splice site	probably null
R1715:Cc2d2a	UTSW	5	43718661	missense	probably damaging	0.97
R1765:Cc2d2a	UTSW	5	43714531	missense	probably damaging	0.99
R1794:Cc2d2a	UTSW	5	43688252	missense	probably damaging	1.00
R1881:Cc2d2a	UTSW	5	43740828	missense	probably damaging	0.99
R1917:Cc2d2a	UTSW	5	43706222	missense	probably damaging	1.00
R2005:Cc2d2a	UTSW	5	43726373	critical splice donor site	probably null
R2201:Cc2d2a	UTSW	5	43684033	splice site	probably benign
R2244:Cc2d2a	UTSW	5	43732433	missense	probably damaging	1.00
R2368:Cc2d2a	UTSW	5	43703888	missense	probably benign
R2442:Cc2d2a	UTSW	5	43671305	critical splice donor site	probably null
R2511:Cc2d2a	UTSW	5	43735395	missense	probably damaging	0.99
R3023:Cc2d2a	UTSW	5	43685251	splice site	probably null
R3147:Cc2d2a	UTSW	5	43709155	missense	probably damaging	1.00
R3148:Cc2d2a	UTSW	5	43709155	missense	probably damaging	1.00
R3426:Cc2d2a	UTSW	5	43736109	missense	probably benign	0.00
R3609:Cc2d2a	UTSW	5	43712326	missense	probably damaging	0.99
R3610:Cc2d2a	UTSW	5	43712326	missense	probably damaging	0.99
R3611:Cc2d2a	UTSW	5	43712326	missense	probably damaging	0.99
R3839:Cc2d2a	UTSW	5	43718714	missense	probably benign
R3870:Cc2d2a	UTSW	5	43718691	nonsense	probably null
R4334:Cc2d2a	UTSW	5	43683134	missense	probably benign	0.00
R4913:Cc2d2a	UTSW	5	43739323	missense	probably benign	0.12
R5179:Cc2d2a	UTSW	5	43688221	missense	possibly damaging	0.82
R5315:Cc2d2a	UTSW	5	43720433	missense	probably damaging	0.99
R5352:Cc2d2a	UTSW	5	43706213	missense	probably damaging	1.00
R5386:Cc2d2a	UTSW	5	43730041	missense	probably benign	0.01
R5538:Cc2d2a	UTSW	5	43695176	missense	possibly damaging	0.94
R5568:Cc2d2a	UTSW	5	43709091	missense	probably damaging	0.99
R5618:Cc2d2a	UTSW	5	43729907	missense	probably benign	0.00
R5653:Cc2d2a	UTSW	5	43722462	missense	possibly damaging	0.81
R5817:Cc2d2a	UTSW	5	43712418	missense	probably damaging	1.00
R5858:Cc2d2a	UTSW	5	43715775	missense	probably damaging	1.00
R5905:Cc2d2a	UTSW	5	43712426	missense	probably benign
R5912:Cc2d2a	UTSW	5	43720430	missense	probably damaging	0.97
R6073:Cc2d2a	UTSW	5	43729975	missense	probably damaging	1.00
R6084:Cc2d2a	UTSW	5	43668673	missense	probably benign
R6176:Cc2d2a	UTSW	5	43709113	missense	probably benign	0.32
R6238:Cc2d2a	UTSW	5	43671235	missense	probably benign	0.11
R6381:Cc2d2a	UTSW	5	43715776	missense	possibly damaging	0.69
R6404:Cc2d2a	UTSW	5	43704074	missense	possibly damaging	0.58
R6455:Cc2d2a	UTSW	5	43739412	missense	possibly damaging	0.69
R6695:Cc2d2a	UTSW	5	43718677	missense	probably damaging	0.99
R6805:Cc2d2a	UTSW	5	43681331	missense	probably damaging	1.00
R6919:Cc2d2a	UTSW	5	43703215	missense	probably benign	0.19
R6970:Cc2d2a	UTSW	5	43718585	missense	probably damaging	1.00
R7024:Cc2d2a	UTSW	5	43733929	missense	probably benign	0.10
R7054:Cc2d2a	UTSW	5	43699979	nonsense	probably null
R7071:Cc2d2a	UTSW	5	43709113	missense	probably benign	0.13
R7098:Cc2d2a	UTSW	5	43683139	missense	probably benign	0.00
R7366:Cc2d2a	UTSW	5	43729990	missense	probably damaging	1.00
R7908:Cc2d2a	UTSW	5	43706846	missense	probably benign	0.00
R7920:Cc2d2a	UTSW	5	43739309	missense	probably benign	0.09
R7950:Cc2d2a	UTSW	5	43695296	critical splice donor site	probably null
R8007:Cc2d2a	UTSW	5	43706100	missense	possibly damaging	0.71
R8117:Cc2d2a	UTSW	5	43712439	missense	probably damaging	1.00
R8123:Cc2d2a	UTSW	5	43710554	missense	probably benign
R8179:Cc2d2a	UTSW	5	43699953	missense	probably damaging	0.96
R8279:Cc2d2a	UTSW	5	43736145	missense	probably benign	0.01
R8293:Cc2d2a	UTSW	5	43688228	missense	probably damaging	0.97
R8480:Cc2d2a	UTSW	5	43685144	splice site	probably null
R8482:Cc2d2a	UTSW	5	43695239	missense	probably damaging	1.00
R8731:Cc2d2a	UTSW	5	43735446	missense	probably damaging	1.00
R8780:Cc2d2a	UTSW	5	43739350	missense	probably damaging	1.00
R8784:Cc2d2a	UTSW	5	43703303	missense	possibly damaging	0.90
R8871:Cc2d2a	UTSW	5	43699943	missense	possibly damaging	0.71
R8972:Cc2d2a	UTSW	5	43710542	missense	probably benign
R9122:Cc2d2a	UTSW	5	43673739	missense	probably null	0.07
R9125:Cc2d2a	UTSW	5	43703221	missense	probably benign
R9203:Cc2d2a	UTSW	5	43733837	missense	probably benign	0.01
R9310:Cc2d2a	UTSW	5	43695146	missense	probably damaging	1.00
R9343:Cc2d2a	UTSW	5	43718657	missense	probably damaging	1.00
R9353:Cc2d2a	UTSW	5	43703349	critical splice donor site	probably null
Z1177:Cc2d2a	UTSW	5	43703204	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TACTAAGTGGTCCACAGCTCTTC -3'
(R):5'- GAGTGATGCTTTGCAAACCTG -3'

Sequencing Primer
(F):5'- TCCCCATGTATACTCACAGGCTAG -3'
(R):5'- AAACCTGGGCTTTCCTCCAG -3'

Posted On

2017-10-10