Incidental Mutation 'R6142:Rpap2'
ID488620
Institutional Source Beutler Lab
Gene Symbol Rpap2
Ensembl Gene ENSMUSG00000033773
Gene NameRNA polymerase II associated protein 2
Synonyms
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6142 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location107597373-107661838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107598298 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 14 (V14A)
Ref Sequence ENSEMBL: ENSMUSP00000121306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065422] [ENSMUST00000078021] [ENSMUST00000082121] [ENSMUST00000100949] [ENSMUST00000112650] [ENSMUST00000112651] [ENSMUST00000112654] [ENSMUST00000112655] [ENSMUST00000124140] [ENSMUST00000124546] [ENSMUST00000129483] [ENSMUST00000150074]
Predicted Effect probably benign
Transcript: ENSMUST00000065422
SMART Domains Protein: ENSMUSP00000070209
Gene: ENSMUSG00000033773

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 80 152 3.6e-26 PFAM
low complexity region 208 221 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078021
SMART Domains Protein: ENSMUSP00000077168
Gene: ENSMUSG00000029276

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 563 5.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082121
SMART Domains Protein: ENSMUSP00000080766
Gene: ENSMUSG00000029276

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 563 3.5e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100949
SMART Domains Protein: ENSMUSP00000098509
Gene: ENSMUSG00000029276

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 404 1.1e-63 PFAM
Pfam:Kinetochor_Ybp2 402 499 1.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112650
SMART Domains Protein: ENSMUSP00000108269
Gene: ENSMUSG00000033773

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 1 74 1.7e-28 PFAM
low complexity region 129 142 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112651
SMART Domains Protein: ENSMUSP00000108270
Gene: ENSMUSG00000033773

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 1 76 1.9e-28 PFAM
low complexity region 131 144 N/A INTRINSIC
low complexity region 296 307 N/A INTRINSIC
low complexity region 482 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112654
SMART Domains Protein: ENSMUSP00000108273
Gene: ENSMUSG00000033773

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 78 153 1.8e-28 PFAM
low complexity region 208 221 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112655
SMART Domains Protein: ENSMUSP00000108274
Gene: ENSMUSG00000033773

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 78 153 4.1e-28 PFAM
low complexity region 208 221 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
low complexity region 560 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124140
SMART Domains Protein: ENSMUSP00000123224
Gene: ENSMUSG00000029276

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 100 5.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124546
SMART Domains Protein: ENSMUSP00000122129
Gene: ENSMUSG00000029276

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 95 6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129483
SMART Domains Protein: ENSMUSP00000142510
Gene: ENSMUSG00000033773

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 1 74 5.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148505
Predicted Effect probably benign
Transcript: ENSMUST00000150074
AA Change: V14A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0456 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Col25a1 T A 3: 130,583,329 probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Rpap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Rpap2 APN 5 107603631 unclassified probably benign
IGL01451:Rpap2 APN 5 107603626 critical splice donor site probably null
IGL01583:Rpap2 APN 5 107620195 missense probably damaging 0.99
IGL01837:Rpap2 APN 5 107625969 critical splice donor site probably null
IGL02343:Rpap2 APN 5 107618181 splice site probably null
IGL02999:Rpap2 APN 5 107601831 missense possibly damaging 0.61
IGL03261:Rpap2 APN 5 107598560 missense possibly damaging 0.95
IGL03381:Rpap2 APN 5 107620201 missense probably benign 0.00
R0077:Rpap2 UTSW 5 107620474 missense probably damaging 1.00
R1698:Rpap2 UTSW 5 107603550 missense probably damaging 1.00
R1897:Rpap2 UTSW 5 107633095 missense possibly damaging 0.85
R3039:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R3605:Rpap2 UTSW 5 107620529 missense probably damaging 1.00
R3735:Rpap2 UTSW 5 107655151 splice site probably benign
R4007:Rpap2 UTSW 5 107603872 missense probably damaging 1.00
R4367:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R4448:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R4589:Rpap2 UTSW 5 107620495 missense probably benign 0.00
R4606:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R4799:Rpap2 UTSW 5 107620247 missense probably benign 0.00
R4939:Rpap2 UTSW 5 107603625 critical splice donor site probably null
R5580:Rpap2 UTSW 5 107620145 missense probably benign 0.12
R6003:Rpap2 UTSW 5 107601901 unclassified probably null
R6032:Rpap2 UTSW 5 107597795 missense probably damaging 0.97
R6032:Rpap2 UTSW 5 107597795 missense probably damaging 0.97
R6161:Rpap2 UTSW 5 107620670 missense probably damaging 1.00
R6687:Rpap2 UTSW 5 107603630 splice site probably null
R6761:Rpap2 UTSW 5 107620238 missense probably benign
R6783:Rpap2 UTSW 5 107655287 missense probably damaging 0.99
R7106:Rpap2 UTSW 5 107633122 nonsense probably null
R7314:Rpap2 UTSW 5 107620379 missense probably damaging 0.96
R7402:Rpap2 UTSW 5 107620458 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCAGTTGCCTTGAACCTTG -3'
(R):5'- TGCCAATGCATTTGATGTAGC -3'

Sequencing Primer
(F):5'- GCCTTGAACCTTGGATTGC -3'
(R):5'- CTCATTTCCAACTTCGATGTG -3'
Posted On2017-10-10