Incidental Mutation 'R6142:Slc13a4'
ID488623
Institutional Source Beutler Lab
Gene Symbol Slc13a4
Ensembl Gene ENSMUSG00000029843
Gene Namesolute carrier family 13 (sodium/sulfate symporters), member 4
Synonyms9630060C05Rik, SUT1, SUT-1
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.781) question?
Stock #R6142 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location35267957-35308131 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35301783 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 57 (A57V)
Ref Sequence ENSEMBL: ENSMUSP00000031868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031868]
Predicted Effect probably damaging
Transcript: ENSMUST00000031868
AA Change: A57V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031868
Gene: ENSMUSG00000029843
AA Change: A57V

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 5 609 3.2e-105 PFAM
Pfam:CitMHS 45 166 1.1e-15 PFAM
Pfam:CitMHS 251 531 8.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122829
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display lethality before birth, impaired placental sulfate transport, failure of bone ossification, impaired vascular development, hemorrhaging, and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Col25a1 T A 3: 130,583,329 probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Slc13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc13a4 APN 6 35289824 missense probably benign 0.01
IGL00975:Slc13a4 APN 6 35274975 missense probably benign 0.18
IGL01069:Slc13a4 APN 6 35268882 missense probably damaging 1.00
IGL01319:Slc13a4 APN 6 35307353 splice site probably null
IGL01560:Slc13a4 APN 6 35271603 splice site probably benign
IGL02125:Slc13a4 APN 6 35278288 missense probably benign 0.23
IGL02415:Slc13a4 APN 6 35283237 critical splice donor site probably null
IGL02888:Slc13a4 APN 6 35268840 missense probably benign 0.10
R0047:Slc13a4 UTSW 6 35287362 missense possibly damaging 0.84
R0047:Slc13a4 UTSW 6 35287362 missense possibly damaging 0.84
R0532:Slc13a4 UTSW 6 35287404 splice site probably null
R0747:Slc13a4 UTSW 6 35278328 missense probably damaging 1.00
R1391:Slc13a4 UTSW 6 35271662 missense probably damaging 0.96
R2106:Slc13a4 UTSW 6 35287864 missense probably damaging 0.99
R2253:Slc13a4 UTSW 6 35280483 missense probably benign 0.00
R3195:Slc13a4 UTSW 6 35268926 missense probably damaging 1.00
R3689:Slc13a4 UTSW 6 35268910 missense possibly damaging 0.87
R3698:Slc13a4 UTSW 6 35274957 missense probably benign 0.06
R3785:Slc13a4 UTSW 6 35287892 missense probably damaging 1.00
R3856:Slc13a4 UTSW 6 35271604 splice site probably null
R5400:Slc13a4 UTSW 6 35301842 nonsense probably null
R6645:Slc13a4 UTSW 6 35268839 missense probably benign 0.19
R6851:Slc13a4 UTSW 6 35301733 missense probably damaging 1.00
R7200:Slc13a4 UTSW 6 35287350 missense possibly damaging 0.56
R7513:Slc13a4 UTSW 6 35283337 intron probably null
Predicted Primers PCR Primer
(F):5'- AGCAGATCAAAGCCTAGTGC -3'
(R):5'- GCCAATGTCAGTATAGCATCTCC -3'

Sequencing Primer
(F):5'- GCCTAGTGCTCAGGAGTCTCTC -3'
(R):5'- GTCAGTATAGCATCTCCCAGTACTG -3'
Posted On2017-10-10