Incidental Mutation 'R6142:Tas2r140'
ID488624
Institutional Source Beutler Lab
Gene Symbol Tas2r140
Ensembl Gene ENSMUSG00000071147
Gene Nametaste receptor, type 2, member 140
SynonymsTas2r40, TRB5, T2R40, TRB3, mTRB3, Tas2r13, mt2r64
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6142 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location133054817-133055816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 133055735 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 20 (G20E)
Ref Sequence ENSEMBL: ENSMUSP00000093040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095391]
Predicted Effect probably damaging
Transcript: ENSMUST00000095391
AA Change: G20E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093040
Gene: ENSMUSG00000071147
AA Change: G20E

DomainStartEndE-ValueType
Pfam:TAS2R 1 301 6.7e-86 PFAM
Meta Mutation Damage Score 0.6685 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Col25a1 T A 3: 130,583,329 probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Tas2r140
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0244:Tas2r140 UTSW 6 133055327 missense possibly damaging 0.46
R0666:Tas2r140 UTSW 6 133055442 missense probably benign 0.22
R1174:Tas2r140 UTSW 6 133054871 missense probably benign 0.27
R1237:Tas2r140 UTSW 6 133055208 missense probably benign 0.04
R1553:Tas2r140 UTSW 6 133055508 missense probably damaging 0.99
R2030:Tas2r140 UTSW 6 133055250 missense probably benign 0.23
R3123:Tas2r140 UTSW 6 133055241 missense probably benign 0.05
R3124:Tas2r140 UTSW 6 133055241 missense probably benign 0.05
R4233:Tas2r140 UTSW 6 133054952 missense probably damaging 1.00
R4234:Tas2r140 UTSW 6 133054952 missense probably damaging 1.00
R4236:Tas2r140 UTSW 6 133054952 missense probably damaging 1.00
R4525:Tas2r140 UTSW 6 133055244 missense possibly damaging 0.66
R4803:Tas2r140 UTSW 6 133055780 missense possibly damaging 0.77
R4840:Tas2r140 UTSW 6 133055565 missense probably benign 0.01
R5317:Tas2r140 UTSW 6 133055580 missense probably benign 0.06
R5937:Tas2r140 UTSW 6 133055273 missense probably benign 0.01
R7127:Tas2r140 UTSW 6 133054959 missense possibly damaging 0.62
R7143:Tas2r140 UTSW 6 133055519 missense probably benign 0.00
R7178:Tas2r140 UTSW 6 133055660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAGACATGTAGCAAGCC -3'
(R):5'- GTGTGTGCAAGATACTTAGTAGC -3'

Sequencing Primer
(F):5'- GAAATGATTGATCACTGTCCAGG -3'
(R):5'- CTGGGCTTTCTTGGACAAAAATG -3'
Posted On2017-10-10