Incidental Mutation 'R6142:Mslnl'
ID 488644
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Name mesothelin-like
Synonyms
MMRRC Submission 044289-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6142 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 25955016-25967304 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25963531 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 339 (L339P)
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098] [ENSMUST00000075884]
AlphaFold Q8C160
Predicted Effect probably damaging
Transcript: ENSMUST00000047098
AA Change: L339P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062
AA Change: L339P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075884
SMART Domains Protein: ENSMUSP00000075279
Gene: ENSMUSG00000063011

DomainStartEndE-ValueType
Pfam:Mesothelin 1 624 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102319
Meta Mutation Damage Score 0.8771 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,496,303 (GRCm39) M579V probably benign Het
Agtr1b T C 3: 20,370,558 (GRCm39) D16G probably benign Het
Akap12 C A 10: 4,263,740 (GRCm39) probably null Het
Alpk2 T C 18: 65,438,456 (GRCm39) E979G possibly damaging Het
Arfgap3 T C 15: 83,234,328 (GRCm39) D8G probably damaging Het
AW551984 G T 9: 39,508,410 (GRCm39) L369I probably benign Het
Bmp8b A T 4: 123,009,043 (GRCm39) H207L probably benign Het
Cc2d2a G T 5: 43,860,540 (GRCm39) V490F probably damaging Het
Cnot6l C T 5: 96,230,837 (GRCm39) V377I probably benign Het
Col25a1 T A 3: 130,376,978 (GRCm39) probably benign Het
Crocc2 C G 1: 93,118,201 (GRCm39) Q375E possibly damaging Het
Ganc T C 2: 120,261,218 (GRCm39) probably null Het
Gm28168 C A 1: 117,875,678 (GRCm39) D102E probably benign Het
Gm8212 T C 14: 44,438,684 (GRCm39) probably null Het
Gria2 T C 3: 80,709,024 (GRCm39) T53A probably benign Het
Hipk4 G A 7: 27,228,590 (GRCm39) V347M probably damaging Het
Hmgxb3 T C 18: 61,269,309 (GRCm39) E991G probably benign Het
Hyal1 G A 9: 107,456,573 (GRCm39) R420H probably benign Het
Il5 G A 11: 53,611,805 (GRCm39) probably null Het
Kcnh7 T C 2: 62,569,704 (GRCm39) I731V possibly damaging Het
Lamb2 A T 9: 108,362,817 (GRCm39) K759* probably null Het
Lnpep A G 17: 17,786,943 (GRCm39) probably null Het
Lrch1 T C 14: 75,184,940 (GRCm39) E54G probably damaging Het
Msl3l2 A G 10: 55,991,461 (GRCm39) D62G possibly damaging Het
Nfe2l2 T C 2: 75,509,761 (GRCm39) I20V probably damaging Het
Pgm5 A C 19: 24,801,772 (GRCm39) I152S probably damaging Het
Plcg2 C A 8: 118,312,010 (GRCm39) T434K probably benign Het
Prrc2c T C 1: 162,537,956 (GRCm39) E558G unknown Het
Ranbp3 T C 17: 56,993,018 (GRCm39) V12A probably benign Het
Rgsl1 A G 1: 153,687,984 (GRCm39) V635A probably benign Het
Rpap2 T C 5: 107,746,164 (GRCm39) V14A probably benign Het
Rxrg G T 1: 167,460,191 (GRCm39) A341S possibly damaging Het
Sbf2 A G 7: 109,948,182 (GRCm39) S1177P probably damaging Het
Sema6a T C 18: 47,414,266 (GRCm39) T498A probably benign Het
Slc13a4 G A 6: 35,278,718 (GRCm39) A57V probably damaging Het
Slc6a3 A T 13: 73,692,902 (GRCm39) D174V probably benign Het
Spart T G 3: 55,024,669 (GRCm39) V88G probably damaging Het
Tanc1 A T 2: 59,663,566 (GRCm39) R1108* probably null Het
Tas2r140 C T 6: 133,032,698 (GRCm39) G20E probably damaging Het
Tdrd6 A G 17: 43,940,373 (GRCm39) V225A probably benign Het
Tmem168 C A 6: 13,591,368 (GRCm39) A99S probably benign Het
Tnk2 T A 16: 32,488,917 (GRCm39) D252E probably damaging Het
Tpsg1 A T 17: 25,591,460 (GRCm39) H20L probably benign Het
Tram1l1 T C 3: 124,115,092 (GRCm39) F84S probably damaging Het
Vmn2r12 T A 5: 109,240,763 (GRCm39) I117L probably benign Het
Zfp148 T C 16: 33,315,829 (GRCm39) L219S possibly damaging Het
Zfp40 C A 17: 23,395,311 (GRCm39) E425D probably benign Het
Zfp773 T C 7: 7,135,481 (GRCm39) T372A probably benign Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25,962,641 (GRCm39) unclassified probably benign
IGL01629:Mslnl APN 17 25,963,749 (GRCm39) missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25,965,125 (GRCm39) missense probably benign 0.07
IGL02408:Mslnl APN 17 25,966,972 (GRCm39) missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25,963,077 (GRCm39) critical splice donor site probably null
IGL03387:Mslnl APN 17 25,963,051 (GRCm39) missense probably benign 0.06
R0561:Mslnl UTSW 17 25,962,177 (GRCm39) nonsense probably null
R0881:Mslnl UTSW 17 25,961,939 (GRCm39) missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25,962,214 (GRCm39) missense probably damaging 1.00
R1296:Mslnl UTSW 17 25,962,214 (GRCm39) missense probably damaging 1.00
R1582:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1629:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1630:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1631:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1632:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1794:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1850:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1866:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1876:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1914:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2166:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2241:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2243:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2247:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2282:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2284:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2852:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2867:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2867:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2877:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2878:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2919:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2920:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3026:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3405:Mslnl UTSW 17 25,965,155 (GRCm39) missense probably damaging 1.00
R3406:Mslnl UTSW 17 25,965,155 (GRCm39) missense probably damaging 1.00
R3411:Mslnl UTSW 17 25,963,491 (GRCm39) missense probably benign 0.05
R3434:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3546:Mslnl UTSW 17 25,963,943 (GRCm39) missense probably damaging 0.98
R3612:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3729:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3730:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3802:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3804:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3894:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3895:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4454:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4455:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4456:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4457:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4561:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4562:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4564:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4600:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4601:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4610:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4704:Mslnl UTSW 17 25,957,952 (GRCm39) missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25,957,942 (GRCm39) nonsense probably null
R5257:Mslnl UTSW 17 25,965,139 (GRCm39) missense probably benign 0.00
R5456:Mslnl UTSW 17 25,962,133 (GRCm39) missense probably damaging 0.98
R5645:Mslnl UTSW 17 25,956,816 (GRCm39) missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25,965,749 (GRCm39) missense probably benign 0.00
R6083:Mslnl UTSW 17 25,956,876 (GRCm39) missense possibly damaging 0.83
R6761:Mslnl UTSW 17 25,965,047 (GRCm39) missense probably damaging 1.00
R7058:Mslnl UTSW 17 25,962,186 (GRCm39) missense probably benign 0.03
R7156:Mslnl UTSW 17 25,962,184 (GRCm39) missense probably benign 0.20
R7467:Mslnl UTSW 17 25,955,895 (GRCm39) start codon destroyed probably benign 0.33
R7687:Mslnl UTSW 17 25,962,157 (GRCm39) missense probably damaging 0.97
R7807:Mslnl UTSW 17 25,965,751 (GRCm39) missense probably benign 0.03
R8682:Mslnl UTSW 17 25,965,962 (GRCm39) missense probably benign
R8735:Mslnl UTSW 17 25,964,062 (GRCm39) missense probably benign 0.09
R8742:Mslnl UTSW 17 25,964,047 (GRCm39) missense probably damaging 1.00
R9208:Mslnl UTSW 17 25,961,694 (GRCm39) missense possibly damaging 0.94
R9264:Mslnl UTSW 17 25,961,506 (GRCm39) intron probably benign
RF007:Mslnl UTSW 17 25,962,202 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GATAGAGTCCCAAAGCCAGC -3'
(R):5'- GCCTATTTCAGCGAGGGAGTAG -3'

Sequencing Primer
(F):5'- GCAAGCTATCATCTCAGACCTTCG -3'
(R):5'- TCCTCAGGGATGCCATGTG -3'
Posted On 2017-10-10