Incidental Mutation 'R6142:Ranbp3'
ID488646
Institutional Source Beutler Lab
Gene Symbol Ranbp3
Ensembl Gene ENSMUSG00000002372
Gene NameRAN binding protein 3
Synonyms2610024N24Rik
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R6142 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location56673225-56711769 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56686018 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 12 (V12A)
Ref Sequence ENSEMBL: ENSMUSP00000002445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002445]
Predicted Effect probably benign
Transcript: ENSMUST00000002445
AA Change: V12A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000002445
Gene: ENSMUSG00000002372
AA Change: V12A

DomainStartEndE-ValueType
low complexity region 275 287 N/A INTRINSIC
RanBD 305 432 1.7e-12 SMART
low complexity region 439 454 N/A INTRINSIC
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a RanBD1 domain that is found in both the nucleus and cytoplasm. This protein plays a role in nuclear export as part of a heteromeric complex. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Col25a1 T A 3: 130,583,329 probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Ranbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Ranbp3 APN 17 56709238 missense probably damaging 1.00
IGL02801:Ranbp3 APN 17 56710766 missense probably benign
IGL03004:Ranbp3 APN 17 56707207 missense probably damaging 1.00
Waif UTSW 17 56677208 intron probably null
R0094:Ranbp3 UTSW 17 56709338 unclassified probably benign
R0139:Ranbp3 UTSW 17 56709272 missense possibly damaging 0.95
R0419:Ranbp3 UTSW 17 56708219 missense possibly damaging 0.92
R0426:Ranbp3 UTSW 17 56707169 missense probably benign
R0629:Ranbp3 UTSW 17 56708200 missense possibly damaging 0.95
R0632:Ranbp3 UTSW 17 56702896 splice site probably benign
R1495:Ranbp3 UTSW 17 56705527 missense probably benign 0.03
R1525:Ranbp3 UTSW 17 56710865 missense possibly damaging 0.52
R2044:Ranbp3 UTSW 17 56673367 start gained probably benign
R2093:Ranbp3 UTSW 17 56710145 missense probably damaging 1.00
R4649:Ranbp3 UTSW 17 56696640 critical splice donor site probably null
R4780:Ranbp3 UTSW 17 56673346 start gained probably benign
R5568:Ranbp3 UTSW 17 56701543 critical splice donor site probably null
R5642:Ranbp3 UTSW 17 56710703 missense probably benign 0.01
R5806:Ranbp3 UTSW 17 56710717 missense probably benign 0.01
R5875:Ranbp3 UTSW 17 56707955 critical splice donor site probably null
R6250:Ranbp3 UTSW 17 56677208 intron probably null
R6745:Ranbp3 UTSW 17 56709308 missense probably benign 0.24
R7222:Ranbp3 UTSW 17 56710211 missense probably damaging 1.00
R7571:Ranbp3 UTSW 17 56707923 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTGATGTATCCTCTGAGCAGC -3'
(R):5'- GAGACCATGTCAAGGGCTGATG -3'

Sequencing Primer
(F):5'- ATCCTCTGAGCAGCTTGGTG -3'
(R):5'- CCATGTCAAGGGCTGATGTTCTG -3'
Posted On2017-10-10