Incidental Mutation 'R6142:Sema6a'
ID488647
Institutional Source Beutler Lab
Gene Symbol Sema6a
Ensembl Gene ENSMUSG00000019647
Gene Namesema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A
Synonymssema, Sema6A-1, Semaq, A730020P05Rik, VIa
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6142 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location47235598-47368870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47281199 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 498 (T498A)
Ref Sequence ENSEMBL: ENSMUSP00000111109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019791] [ENSMUST00000076043] [ENSMUST00000115449] [ENSMUST00000135790] [ENSMUST00000156422]
Predicted Effect probably benign
Transcript: ENSMUST00000019791
AA Change: T524A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019791
Gene: ENSMUSG00000019647
AA Change: T524A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 648 670 N/A INTRINSIC
low complexity region 932 951 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076043
AA Change: T524A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075420
Gene: ENSMUSG00000019647
AA Change: T524A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 593 615 N/A INTRINSIC
low complexity region 877 896 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115449
AA Change: T498A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000111109
Gene: ENSMUSG00000019647
AA Change: T498A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 461 1.24e-168 SMART
PSI 488 543 9.57e-1 SMART
transmembrane domain 622 644 N/A INTRINSIC
low complexity region 906 925 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123228
SMART Domains Protein: ENSMUSP00000120249
Gene: ENSMUSG00000019647

DomainStartEndE-ValueType
Blast:PSI 2 45 4e-26 BLAST
PDB:3OKY|B 2 47 2e-26 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000135790
AA Change: T524A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120011
Gene: ENSMUSG00000019647
AA Change: T524A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 949 968 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151382
Predicted Effect probably benign
Transcript: ENSMUST00000156422
AA Change: T524A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121442
Gene: ENSMUSG00000019647
AA Change: T524A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 648 670 N/A INTRINSIC
low complexity region 932 951 N/A INTRINSIC
Meta Mutation Damage Score 0.0634 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transmembrane semaphorin SEMA6A is expressed in developing neural tissue and is required for proper development of the thalamocortical projection (Leighton et al., 2001 [PubMed 11242070]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit defects in lamina-specific neurite stratification of specific retinal neuron subtypes and disruption of the dendritic plexus organization of On but not Off starburst amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Col25a1 T A 3: 130,583,329 probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tanc1 A T 2: 59,833,222 R1108* probably null Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Sema6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Sema6a APN 18 47289975 critical splice donor site probably null
IGL01351:Sema6a APN 18 47281302 missense possibly damaging 0.84
IGL01594:Sema6a APN 18 47248817 missense probably damaging 1.00
IGL01953:Sema6a APN 18 47290120 nonsense probably null
IGL02077:Sema6a APN 18 47283398 missense possibly damaging 0.94
IGL02632:Sema6a APN 18 47290155 missense probably damaging 1.00
IGL02957:Sema6a APN 18 47249224 missense probably damaging 1.00
IGL03013:Sema6a APN 18 47248394 missense probably benign 0.01
IGL03279:Sema6a APN 18 47300090 nonsense probably null
saphire UTSW 18 47306429 nonsense probably null
IGL02988:Sema6a UTSW 18 47298214 missense probably damaging 1.00
R0114:Sema6a UTSW 18 47290177 missense probably damaging 1.00
R0311:Sema6a UTSW 18 47290045 unclassified probably null
R0312:Sema6a UTSW 18 47290045 unclassified probably null
R0347:Sema6a UTSW 18 47291129 missense probably damaging 1.00
R0350:Sema6a UTSW 18 47270718 missense probably benign
R0366:Sema6a UTSW 18 47290045 unclassified probably null
R0368:Sema6a UTSW 18 47290045 unclassified probably null
R0391:Sema6a UTSW 18 47290045 unclassified probably null
R0403:Sema6a UTSW 18 47290045 unclassified probably null
R0466:Sema6a UTSW 18 47290045 unclassified probably null
R0515:Sema6a UTSW 18 47290045 unclassified probably null
R0517:Sema6a UTSW 18 47290045 unclassified probably null
R0542:Sema6a UTSW 18 47248576 missense probably damaging 1.00
R0557:Sema6a UTSW 18 47249500 missense probably benign 0.01
R0569:Sema6a UTSW 18 47270805 splice site probably null
R0650:Sema6a UTSW 18 47290045 unclassified probably null
R0689:Sema6a UTSW 18 47290045 unclassified probably null
R0694:Sema6a UTSW 18 47290045 unclassified probably null
R0726:Sema6a UTSW 18 47291981 missense probably damaging 1.00
R0741:Sema6a UTSW 18 47290045 unclassified probably null
R0821:Sema6a UTSW 18 47290045 unclassified probably null
R0824:Sema6a UTSW 18 47290045 unclassified probably null
R0924:Sema6a UTSW 18 47248492 missense probably damaging 1.00
R1108:Sema6a UTSW 18 47306431 missense probably benign 0.02
R1255:Sema6a UTSW 18 47249299 missense probably damaging 0.98
R1422:Sema6a UTSW 18 47306431 missense probably benign 0.02
R1531:Sema6a UTSW 18 47248999 missense probably damaging 1.00
R1707:Sema6a UTSW 18 47283445 missense probably benign 0.04
R1746:Sema6a UTSW 18 47306349 splice site probably benign
R1807:Sema6a UTSW 18 47276424 missense possibly damaging 0.85
R1974:Sema6a UTSW 18 47270629 missense probably benign 0.04
R1987:Sema6a UTSW 18 47300142 missense probably damaging 1.00
R2044:Sema6a UTSW 18 47306429 nonsense probably null
R3719:Sema6a UTSW 18 47249077 missense probably damaging 1.00
R4491:Sema6a UTSW 18 47306457 utr 5 prime probably benign
R4552:Sema6a UTSW 18 47291923 missense probably damaging 1.00
R4707:Sema6a UTSW 18 47248712 missense probably benign 0.43
R4710:Sema6a UTSW 18 47270683 missense probably benign 0.00
R4713:Sema6a UTSW 18 47249296 missense possibly damaging 0.79
R4963:Sema6a UTSW 18 47298251 missense possibly damaging 0.48
R5088:Sema6a UTSW 18 47249129 missense probably damaging 1.00
R5133:Sema6a UTSW 18 47300128 missense probably damaging 1.00
R5135:Sema6a UTSW 18 47291172 missense probably damaging 1.00
R5141:Sema6a UTSW 18 47248388 missense probably damaging 1.00
R5277:Sema6a UTSW 18 47276544 intron probably benign
R5551:Sema6a UTSW 18 47248528 missense possibly damaging 0.76
R5618:Sema6a UTSW 18 47281948 missense probably damaging 0.98
R5717:Sema6a UTSW 18 47249263 missense probably benign 0.01
R5729:Sema6a UTSW 18 47281343 missense probably damaging 1.00
R5779:Sema6a UTSW 18 47248826 missense probably damaging 1.00
R5917:Sema6a UTSW 18 47281338 missense probably benign 0.05
R6054:Sema6a UTSW 18 47283403 missense possibly damaging 0.94
R6209:Sema6a UTSW 18 47298302 splice site probably null
R6307:Sema6a UTSW 18 47249164 missense probably damaging 1.00
R6734:Sema6a UTSW 18 47279169 missense probably benign 0.31
R7014:Sema6a UTSW 18 47298217 missense probably damaging 1.00
R7033:Sema6a UTSW 18 47248570 missense probably damaging 0.96
R7574:Sema6a UTSW 18 47291164 missense probably damaging 1.00
X0065:Sema6a UTSW 18 47283319 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CGTGGCTGAAATTTTCTCACATG -3'
(R):5'- AAGGATCATGGGCATGCAGC -3'

Sequencing Primer
(F):5'- TCACATGGAGAAATGAGTTCAGATG -3'
(R):5'- TCGACAGAGCGAGTGGC -3'
Posted On2017-10-10