Mutagenetix > Incidental Mutation

Incidental Mutation 'R6143:Slc19a3'

488656

Institutional Source

Beutler Lab

Gene Symbol

Slc19a3

Ensembl Gene

ENSMUSG00000038496

Gene Name

solute carrier family 19, member 3

Synonyms

ThTr2, A230084E24Rik

MMRRC Submission

044290-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.109) question?

Stock #

R6143 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83012523-83038448 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 83026339 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 14 (V14I)

Ref Sequence

ENSEMBL: ENSMUSP00000126646 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473]

AlphaFold

Q99PL8

Predicted Effect

probably benign
Transcript: ENSMUST00000045560
AA Change: V14I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496
AA Change: V14I

Domain	Start	End	E-Value	Type
Pfam:Folate_carrier	11	435	1.4e-178	PFAM
Pfam:MFS_1	16	416	1.6e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164473
AA Change: V14I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496
AA Change: V14I

Domain	Start	End	E-Value	Type
Pfam:Folate_carrier	11	435	1.3e-178	PFAM
Pfam:MFS_1	16	416	1.9e-17	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.1%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed transmembrane thiamine transporter that lacks folate transport activity. Mutations in this gene cause biotin-responsive basal ganglia disease (BBGD); a recessive disorder manifested in childhood that progresses to chronic encephalopathy, dystonia, quadriparesis, and death if untreated. Patients with BBGD have bilateral necrosis in the head of the caudate nucleus and in the putamen. Administration of high doses of biotin in the early progression of the disorder eliminates pathological symptoms while delayed treatment results in residual paraparesis, mild mental retardation, or dystonia. Administration of thiamine is ineffective in the treatment of this disorder. Experiments have failed to show that this protein can transport biotin. Mutations in this gene also cause a Wernicke's-like encephalopathy.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death within a year of age, impaired thiamin uptake, lethargy, cachexia, injured liver parenchyma, hepatic necrosis, liver and kidney inflammmation, and nephrosclerosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730061H03Rik	A	G	14: 55,560,279		probably benign	Het
Abcd2	A	T	15: 91,190,947	V221E	possibly damaging	Het
Arhgap39	T	A	15: 76,730,406	K853*	probably null	Het
Art2a-ps	T	C	7: 101,555,223	D36G	possibly damaging	Het
Atp13a1	C	T	8: 69,805,360	P922S	probably benign	Het
Brwd1	C	T	16: 96,002,956	G2005R	probably benign	Het
Bzw2	A	T	12: 36,120,726	M133K	probably benign	Het
Cacna1s	T	G	1: 136,076,758	S346A	probably damaging	Het
Cebpb	C	A	2: 167,689,300	D93E	probably benign	Het
Cep162	C	A	9: 87,212,851		probably null	Het
Col9a2	A	T	4: 121,053,863	Y565F	probably damaging	Het
Csgalnact1	T	A	8: 68,373,550	N372I	probably damaging	Het
Csmd1	T	C	8: 16,088,301	D1579G	probably damaging	Het
Cyfip2	A	C	11: 46,253,965	Y687*	probably null	Het
Cyp2d34	G	A	15: 82,620,776	R28W	probably benign	Het
Dbndd2	C	A	2: 164,488,286	Q13K	probably damaging	Het
Dnah5	T	A	15: 28,233,231	S245R	probably benign	Het
Dnajb5	A	T	4: 42,956,990	T226S	probably damaging	Het
Dnmt1	T	C	9: 20,927,134	E211G	probably benign	Het
Dnpep	G	A	1: 75,315,228	H214Y	probably damaging	Het
Drc3	G	A	11: 60,370,580	V186M	possibly damaging	Het
Dvl3	A	G	16: 20,527,039	D413G	possibly damaging	Het
Dyrk4	C	T	6: 126,886,651		probably null	Het
Edc4	T	A	8: 105,885,874	D181E	probably damaging	Het
Enthd1	T	C	15: 80,509,286	Y247C	possibly damaging	Het
Gm5622	A	T	14: 51,654,915	R50S	possibly damaging	Het
Gpbp1	G	A	13: 111,466,855	T20I	probably damaging	Het
Hnrnpdl	A	T	5: 100,036,551	Y276*	probably null	Het
Hsd3b7	A	C	7: 127,801,232	E51A	probably damaging	Het
Ighv5-16	G	T	12: 113,838,618	F87L	probably damaging	Het
Iqsec1	C	T	6: 90,809,684		probably null	Het
Irgm2	A	T	11: 58,220,609	E387D	possibly damaging	Het
Klhl23	C	A	2: 69,833,696	P463Q	possibly damaging	Het
Mast4	A	T	13: 102,853,883	N43K	probably damaging	Het
Mme	T	G	3: 63,300,111		probably null	Het
Mrps31	T	G	8: 22,411,523	S20A	probably benign	Het
Myo5c	A	G	9: 75,249,809	R176G	probably damaging	Het
Naf1	T	C	8: 66,877,695	V291A	possibly damaging	Het
Nbeal1	A	T	1: 60,251,307	H1021L	possibly damaging	Het
Ncaph2	T	C	15: 89,364,003		probably null	Het
Neurod4	T	G	10: 130,271,000	Y135S	probably damaging	Het
Nrp2	A	T	1: 62,760,815	N396I	probably damaging	Het
Nvl	T	G	1: 181,134,995	T137P	probably benign	Het
Olfr483	A	G	7: 108,104,128	D273G	probably damaging	Het
Papola	T	C	12: 105,826,960	V513A	probably benign	Het
Pcdhgc4	T	A	18: 37,817,600	S690T	possibly damaging	Het
Pck1	A	T	2: 173,154,012	D101V	probably damaging	Het
Pdilt	T	A	7: 119,495,042	N329Y	probably damaging	Het
Pfkl	T	A	10: 77,989,613	R648W	probably damaging	Het
Prtn3	T	A	10: 79,880,548	I63N	probably damaging	Het
Psg22	C	T	7: 18,722,798	A163V	probably benign	Het
Pten	A	G	19: 32,800,085	T160A	possibly damaging	Het
Retreg2	A	G	1: 75,146,886	D449G	probably damaging	Het
Scn9a	T	C	2: 66,487,524	Y1531C	probably benign	Het
Sgk2	T	A	2: 162,999,254	C195S	probably damaging	Het
Snai2	A	T	16: 14,708,243	R253*	probably null	Het
Speg	G	A	1: 75,414,387	V1512I	probably damaging	Het
Srsf1	G	A	11: 88,049,599		probably benign	Het
Tctn3	G	T	19: 40,609,227	T190N	probably benign	Het
Tmprss11f	T	A	5: 86,539,699	I117L	probably benign	Het
Ttn	G	A	2: 76,852,069	R959*	probably null	Het
Vmn2r118	G	T	17: 55,592,871	L678I	possibly damaging	Het
Vps13b	T	C	15: 35,668,738	S1594P	probably damaging	Het
Vps13d	G	T	4: 145,148,565	H1791N	possibly damaging	Het

Other mutations in Slc19a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03066:Slc19a3	APN	1	83014836	missense	probably damaging	0.99
tag	UTSW	1	83026260	missense	probably damaging	1.00
R0437:Slc19a3	UTSW	1	83022565	missense	probably benign	0.00
R0526:Slc19a3	UTSW	1	83022733	missense	probably damaging	1.00
R1160:Slc19a3	UTSW	1	83022692	missense	possibly damaging	0.85
R1306:Slc19a3	UTSW	1	83022762	missense	probably damaging	1.00
R1832:Slc19a3	UTSW	1	83022747	missense	probably damaging	0.99
R1938:Slc19a3	UTSW	1	83019368	missense	possibly damaging	0.76
R1961:Slc19a3	UTSW	1	83022798	missense	probably benign	0.00
R2058:Slc19a3	UTSW	1	83014791	missense	probably damaging	0.98
R2200:Slc19a3	UTSW	1	83022943	missense	probably damaging	0.96
R2245:Slc19a3	UTSW	1	83013970	missense	possibly damaging	0.84
R2261:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R2404:Slc19a3	UTSW	1	83023035	missense	probably benign	0.16
R3891:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R3892:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R3907:Slc19a3	UTSW	1	83014813	missense	possibly damaging	0.76
R3912:Slc19a3	UTSW	1	83022703	missense	probably benign	0.09
R3922:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R3923:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R3961:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R4083:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R4106:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R4107:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R4109:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R4667:Slc19a3	UTSW	1	83022799	missense	probably benign
R4768:Slc19a3	UTSW	1	83023113	missense	probably damaging	1.00
R4769:Slc19a3	UTSW	1	83019341	missense	probably damaging	1.00
R5001:Slc19a3	UTSW	1	83022620	missense	probably benign	0.33
R5538:Slc19a3	UTSW	1	83022561	missense	possibly damaging	0.51
R5588:Slc19a3	UTSW	1	83023055	nonsense	probably null
R6546:Slc19a3	UTSW	1	83026360	missense	probably benign	0.02
R6547:Slc19a3	UTSW	1	83022900	missense	probably damaging	1.00
R7059:Slc19a3	UTSW	1	83022369	missense	probably damaging	1.00
R7497:Slc19a3	UTSW	1	83013928	missense	probably damaging	1.00
R7509:Slc19a3	UTSW	1	83026260	missense	probably damaging	1.00
R7584:Slc19a3	UTSW	1	83022748	missense	possibly damaging	0.79
R7810:Slc19a3	UTSW	1	83019441	missense	probably benign	0.02
R8150:Slc19a3	UTSW	1	83022495	missense	probably damaging	1.00
R8412:Slc19a3	UTSW	1	83014812	missense	probably damaging	0.97
R8970:Slc19a3	UTSW	1	83023101	missense	probably damaging	1.00
R9314:Slc19a3	UTSW	1	83022373	missense	possibly damaging	0.62
R9671:Slc19a3	UTSW	1	83022576	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCTTGTTCAAGCTCTGAGCAG -3'
(R):5'- GGCTCTGGAAACATAGGGATC -3'

Sequencing Primer
(F):5'- TGAGCAGTTAACCCCTACTGAGATG -3'
(R):5'- GATCACCCTCGAATTGTGTGTAAG -3'

Posted On

2017-10-10