Incidental Mutation 'R6143:Nvl'
ID 488658
Institutional Source Beutler Lab
Gene Symbol Nvl
Ensembl Gene ENSMUSG00000026516
Gene Name nuclear VCP-like
Synonyms 1200009I24Rik
MMRRC Submission 044290-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R6143 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 180914703-180971769 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 180962560 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 137 (T137P)
Ref Sequence ENSEMBL: ENSMUSP00000027797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027797]
AlphaFold Q9DBY8
PDB Structure Structure and function of the N-terminal nucleolin binding domain of nuclear valocine containing protein like 2 (NVL2) harboring a nucleolar localization signal [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000027797
AA Change: T137P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000027797
Gene: ENSMUSG00000026516
AA Change: T137P

DomainStartEndE-ValueType
Pfam:Nucleolin_bd 2 72 1.9e-31 PFAM
low complexity region 90 104 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
AAA 296 435 2.94e-23 SMART
low complexity region 524 540 N/A INTRINSIC
AAA 613 749 2.56e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193758
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. Two encoded proteins, described as major and minor isoforms, have been localized to distinct regions of the nucleus. The largest encoded protein (major isoform) has been localized to the nucleolus and shown to participate in ribosome biosynthesis (PMID: 15469983, 16782053), while the minor isoform has been localized to the nucleoplasmin. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730061H03Rik A G 14: 55,797,736 (GRCm39) probably benign Het
Abcd2 A T 15: 91,075,150 (GRCm39) V221E possibly damaging Het
Arhgap39 T A 15: 76,614,606 (GRCm39) K853* probably null Het
Art2a T C 7: 101,204,430 (GRCm39) D36G possibly damaging Het
Atp13a1 C T 8: 70,258,010 (GRCm39) P922S probably benign Het
Brwd1 C T 16: 95,804,156 (GRCm39) G2005R probably benign Het
Bzw2 A T 12: 36,170,725 (GRCm39) M133K probably benign Het
Cacna1s T G 1: 136,004,496 (GRCm39) S346A probably damaging Het
Cebpb C A 2: 167,531,220 (GRCm39) D93E probably benign Het
Cep162 C A 9: 87,094,904 (GRCm39) probably null Het
Col9a2 A T 4: 120,911,060 (GRCm39) Y565F probably damaging Het
Csgalnact1 T A 8: 68,826,202 (GRCm39) N372I probably damaging Het
Csmd1 T C 8: 16,138,315 (GRCm39) D1579G probably damaging Het
Cyfip2 A C 11: 46,144,792 (GRCm39) Y687* probably null Het
Cyp2d34 G A 15: 82,504,977 (GRCm39) R28W probably benign Het
Dbndd2 C A 2: 164,330,206 (GRCm39) Q13K probably damaging Het
Dnah5 T A 15: 28,233,377 (GRCm39) S245R probably benign Het
Dnajb5 A T 4: 42,956,990 (GRCm39) T226S probably damaging Het
Dnmt1 T C 9: 20,838,430 (GRCm39) E211G probably benign Het
Dnpep G A 1: 75,291,872 (GRCm39) H214Y probably damaging Het
Drc3 G A 11: 60,261,406 (GRCm39) V186M possibly damaging Het
Dvl3 A G 16: 20,345,789 (GRCm39) D413G possibly damaging Het
Dyrk4 C T 6: 126,863,614 (GRCm39) probably null Het
Edc4 T A 8: 106,612,506 (GRCm39) D181E probably damaging Het
Enthd1 T C 15: 80,393,487 (GRCm39) Y247C possibly damaging Het
Gm5622 A T 14: 51,892,372 (GRCm39) R50S possibly damaging Het
Gpbp1 G A 13: 111,603,389 (GRCm39) T20I probably damaging Het
Hnrnpdl A T 5: 100,184,410 (GRCm39) Y276* probably null Het
Hsd3b7 A C 7: 127,400,404 (GRCm39) E51A probably damaging Het
Ighv5-16 G T 12: 113,802,238 (GRCm39) F87L probably damaging Het
Iqsec1 C T 6: 90,786,666 (GRCm39) probably null Het
Irgm2 A T 11: 58,111,435 (GRCm39) E387D possibly damaging Het
Klhl23 C A 2: 69,664,040 (GRCm39) P463Q possibly damaging Het
Mast4 A T 13: 102,990,391 (GRCm39) N43K probably damaging Het
Mme T G 3: 63,207,532 (GRCm39) probably null Het
Mrps31 T G 8: 22,901,539 (GRCm39) S20A probably benign Het
Myo5c A G 9: 75,157,091 (GRCm39) R176G probably damaging Het
Naf1 T C 8: 67,330,347 (GRCm39) V291A possibly damaging Het
Nbeal1 A T 1: 60,290,466 (GRCm39) H1021L possibly damaging Het
Ncaph2 T C 15: 89,248,206 (GRCm39) probably null Het
Neurod4 T G 10: 130,106,869 (GRCm39) Y135S probably damaging Het
Nrp2 A T 1: 62,799,974 (GRCm39) N396I probably damaging Het
Or5p59 A G 7: 107,703,335 (GRCm39) D273G probably damaging Het
Papola T C 12: 105,793,219 (GRCm39) V513A probably benign Het
Pcdhgc4 T A 18: 37,950,653 (GRCm39) S690T possibly damaging Het
Pck1 A T 2: 172,995,805 (GRCm39) D101V probably damaging Het
Pdilt T A 7: 119,094,265 (GRCm39) N329Y probably damaging Het
Pfkl T A 10: 77,825,447 (GRCm39) R648W probably damaging Het
Prtn3 T A 10: 79,716,382 (GRCm39) I63N probably damaging Het
Psg22 C T 7: 18,456,723 (GRCm39) A163V probably benign Het
Pten A G 19: 32,777,485 (GRCm39) T160A possibly damaging Het
Retreg2 A G 1: 75,123,530 (GRCm39) D449G probably damaging Het
Scn9a T C 2: 66,317,868 (GRCm39) Y1531C probably benign Het
Sgk2 T A 2: 162,841,174 (GRCm39) C195S probably damaging Het
Slc19a3 C T 1: 83,004,060 (GRCm39) V14I probably benign Het
Snai2 A T 16: 14,526,107 (GRCm39) R253* probably null Het
Speg G A 1: 75,391,031 (GRCm39) V1512I probably damaging Het
Srsf1 G A 11: 87,940,425 (GRCm39) probably benign Het
Tctn3 G T 19: 40,597,671 (GRCm39) T190N probably benign Het
Tmprss11f T A 5: 86,687,558 (GRCm39) I117L probably benign Het
Ttn G A 2: 76,682,413 (GRCm39) R959* probably null Het
Vmn2r118 G T 17: 55,899,871 (GRCm39) L678I possibly damaging Het
Vps13b T C 15: 35,668,884 (GRCm39) S1594P probably damaging Het
Vps13d G T 4: 144,875,135 (GRCm39) H1791N possibly damaging Het
Other mutations in Nvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Nvl APN 1 180,932,690 (GRCm39) missense probably damaging 1.00
IGL00943:Nvl APN 1 180,929,199 (GRCm39) missense possibly damaging 0.72
IGL01956:Nvl APN 1 180,962,509 (GRCm39) missense probably benign 0.00
IGL02657:Nvl APN 1 180,934,541 (GRCm39) missense probably damaging 1.00
Nineveh UTSW 1 180,964,471 (GRCm39) missense probably benign 0.00
nubia UTSW 1 180,939,899 (GRCm39) missense probably benign 0.19
IGL03098:Nvl UTSW 1 180,921,471 (GRCm39) missense probably benign 0.37
P0047:Nvl UTSW 1 180,939,867 (GRCm39) missense probably damaging 1.00
R0003:Nvl UTSW 1 180,941,698 (GRCm39) missense probably damaging 1.00
R0114:Nvl UTSW 1 180,947,956 (GRCm39) missense probably benign 0.19
R0265:Nvl UTSW 1 180,962,395 (GRCm39) missense probably damaging 0.96
R0928:Nvl UTSW 1 180,921,467 (GRCm39) missense probably benign 0.00
R1398:Nvl UTSW 1 180,924,691 (GRCm39) splice site probably benign
R1470:Nvl UTSW 1 180,966,827 (GRCm39) missense probably damaging 1.00
R1470:Nvl UTSW 1 180,966,827 (GRCm39) missense probably damaging 1.00
R1529:Nvl UTSW 1 180,936,724 (GRCm39) critical splice donor site probably null
R1934:Nvl UTSW 1 180,926,693 (GRCm39) missense probably damaging 0.96
R2176:Nvl UTSW 1 180,962,639 (GRCm39) splice site probably benign
R2351:Nvl UTSW 1 180,958,357 (GRCm39) missense probably benign 0.03
R4415:Nvl UTSW 1 180,932,679 (GRCm39) missense probably benign
R4570:Nvl UTSW 1 180,971,647 (GRCm39) missense probably benign 0.03
R4720:Nvl UTSW 1 180,929,152 (GRCm39) missense probably damaging 1.00
R4888:Nvl UTSW 1 180,945,191 (GRCm39) missense probably damaging 1.00
R5026:Nvl UTSW 1 180,932,720 (GRCm39) missense probably damaging 1.00
R5507:Nvl UTSW 1 180,962,601 (GRCm39) missense probably damaging 0.98
R5785:Nvl UTSW 1 180,966,863 (GRCm39) missense probably damaging 1.00
R5983:Nvl UTSW 1 180,964,471 (GRCm39) missense probably benign 0.00
R6532:Nvl UTSW 1 180,971,708 (GRCm39) splice site probably null
R6821:Nvl UTSW 1 180,954,535 (GRCm39) nonsense probably null
R7062:Nvl UTSW 1 180,939,899 (GRCm39) missense probably benign 0.19
R7247:Nvl UTSW 1 180,939,851 (GRCm39) critical splice donor site probably null
R7358:Nvl UTSW 1 180,962,601 (GRCm39) missense probably damaging 0.98
R7665:Nvl UTSW 1 180,962,509 (GRCm39) missense probably benign 0.18
R7795:Nvl UTSW 1 180,924,722 (GRCm39) missense probably benign 0.00
R7931:Nvl UTSW 1 180,936,720 (GRCm39) splice site probably benign
R8185:Nvl UTSW 1 180,971,739 (GRCm39) unclassified probably benign
R8806:Nvl UTSW 1 180,922,619 (GRCm39) missense probably benign 0.01
R8933:Nvl UTSW 1 180,966,638 (GRCm39) missense probably benign 0.00
R8975:Nvl UTSW 1 180,958,001 (GRCm39) missense probably benign
R9249:Nvl UTSW 1 180,962,593 (GRCm39) missense probably damaging 1.00
R9584:Nvl UTSW 1 180,958,431 (GRCm39) missense probably benign
R9586:Nvl UTSW 1 180,932,635 (GRCm39) critical splice donor site probably null
X0067:Nvl UTSW 1 180,966,723 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TTGGTCATCTGATAGGTCCAAGG -3'
(R):5'- CCAAGAGTGGTTTAGTAGTTTCAG -3'

Sequencing Primer
(F):5'- TCTGATAGGTCCAAGGGAAGACTTTC -3'
(R):5'- GTTTGGGAGTTTTATAACTGACAACC -3'
Posted On 2017-10-10