Incidental Mutation 'R6143:Nvl'
ID488658
Institutional Source Beutler Lab
Gene Symbol Nvl
Ensembl Gene ENSMUSG00000026516
Gene Namenuclear VCP-like
Synonyms1200009I24Rik
MMRRC Submission 044290-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R6143 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location181087138-181144204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 181134995 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 137 (T137P)
Ref Sequence ENSEMBL: ENSMUSP00000027797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027797]
PDB Structure Structure and function of the N-terminal nucleolin binding domain of nuclear valocine containing protein like 2 (NVL2) harboring a nucleolar localization signal [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000027797
AA Change: T137P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000027797
Gene: ENSMUSG00000026516
AA Change: T137P

DomainStartEndE-ValueType
Pfam:Nucleolin_bd 2 72 1.9e-31 PFAM
low complexity region 90 104 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
AAA 296 435 2.94e-23 SMART
low complexity region 524 540 N/A INTRINSIC
AAA 613 749 2.56e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193758
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. Two encoded proteins, described as major and minor isoforms, have been localized to distinct regions of the nucleus. The largest encoded protein (major isoform) has been localized to the nucleolus and shown to participate in ribosome biosynthesis (PMID: 15469983, 16782053), while the minor isoform has been localized to the nucleoplasmin. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730061H03Rik A G 14: 55,560,279 probably benign Het
Abcd2 A T 15: 91,190,947 V221E possibly damaging Het
Arhgap39 T A 15: 76,730,406 K853* probably null Het
Art2a-ps T C 7: 101,555,223 D36G possibly damaging Het
Atp13a1 C T 8: 69,805,360 P922S probably benign Het
Brwd1 C T 16: 96,002,956 G2005R probably benign Het
Bzw2 A T 12: 36,120,726 M133K probably benign Het
Cacna1s T G 1: 136,076,758 S346A probably damaging Het
Cebpb C A 2: 167,689,300 D93E probably benign Het
Cep162 C A 9: 87,212,851 probably null Het
Col9a2 A T 4: 121,053,863 Y565F probably damaging Het
Csgalnact1 T A 8: 68,373,550 N372I probably damaging Het
Csmd1 T C 8: 16,088,301 D1579G probably damaging Het
Cyfip2 A C 11: 46,253,965 Y687* probably null Het
Cyp2d34 G A 15: 82,620,776 R28W probably benign Het
Dbndd2 C A 2: 164,488,286 Q13K probably damaging Het
Dnah5 T A 15: 28,233,231 S245R probably benign Het
Dnajb5 A T 4: 42,956,990 T226S probably damaging Het
Dnmt1 T C 9: 20,927,134 E211G probably benign Het
Dnpep G A 1: 75,315,228 H214Y probably damaging Het
Drc3 G A 11: 60,370,580 V186M possibly damaging Het
Dvl3 A G 16: 20,527,039 D413G possibly damaging Het
Dyrk4 C T 6: 126,886,651 probably null Het
Edc4 T A 8: 105,885,874 D181E probably damaging Het
Enthd1 T C 15: 80,509,286 Y247C possibly damaging Het
Gm5622 A T 14: 51,654,915 R50S possibly damaging Het
Gpbp1 G A 13: 111,466,855 T20I probably damaging Het
Hnrnpdl A T 5: 100,036,551 Y276* probably null Het
Hsd3b7 A C 7: 127,801,232 E51A probably damaging Het
Ighv5-16 G T 12: 113,838,618 F87L probably damaging Het
Iqsec1 C T 6: 90,809,684 probably null Het
Irgm2 A T 11: 58,220,609 E387D possibly damaging Het
Klhl23 C A 2: 69,833,696 P463Q possibly damaging Het
Mast4 A T 13: 102,853,883 N43K probably damaging Het
Mme T G 3: 63,300,111 probably null Het
Mrps31 T G 8: 22,411,523 S20A probably benign Het
Myo5c A G 9: 75,249,809 R176G probably damaging Het
Naf1 T C 8: 66,877,695 V291A possibly damaging Het
Nbeal1 A T 1: 60,251,307 H1021L possibly damaging Het
Ncaph2 T C 15: 89,364,003 probably null Het
Neurod4 T G 10: 130,271,000 Y135S probably damaging Het
Nrp2 A T 1: 62,760,815 N396I probably damaging Het
Olfr483 A G 7: 108,104,128 D273G probably damaging Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pcdhgc4 T A 18: 37,817,600 S690T possibly damaging Het
Pck1 A T 2: 173,154,012 D101V probably damaging Het
Pdilt T A 7: 119,495,042 N329Y probably damaging Het
Pfkl T A 10: 77,989,613 R648W probably damaging Het
Prtn3 T A 10: 79,880,548 I63N probably damaging Het
Psg22 C T 7: 18,722,798 A163V probably benign Het
Pten A G 19: 32,800,085 T160A possibly damaging Het
Retreg2 A G 1: 75,146,886 D449G probably damaging Het
Scn9a T C 2: 66,487,524 Y1531C probably benign Het
Sgk2 T A 2: 162,999,254 C195S probably damaging Het
Slc19a3 C T 1: 83,026,339 V14I probably benign Het
Snai2 A T 16: 14,708,243 R253* probably null Het
Speg G A 1: 75,414,387 V1512I probably damaging Het
Srsf1 G A 11: 88,049,599 probably benign Het
Tctn3 G T 19: 40,609,227 T190N probably benign Het
Tmprss11f T A 5: 86,539,699 I117L probably benign Het
Ttn G A 2: 76,852,069 R959* probably null Het
Vmn2r118 G T 17: 55,592,871 L678I possibly damaging Het
Vps13b T C 15: 35,668,738 S1594P probably damaging Het
Vps13d G T 4: 145,148,565 H1791N possibly damaging Het
Other mutations in Nvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Nvl APN 1 181105125 missense probably damaging 1.00
IGL00943:Nvl APN 1 181101634 missense possibly damaging 0.72
IGL01956:Nvl APN 1 181134944 missense probably benign 0.00
IGL02657:Nvl APN 1 181106976 missense probably damaging 1.00
nineveh UTSW 1 181136906 missense probably benign 0.00
nubia UTSW 1 181112334 missense probably benign 0.19
IGL03098:Nvl UTSW 1 181093906 missense probably benign 0.37
P0047:Nvl UTSW 1 181112302 missense probably damaging 1.00
R0003:Nvl UTSW 1 181114133 missense probably damaging 1.00
R0114:Nvl UTSW 1 181120391 missense probably benign 0.19
R0265:Nvl UTSW 1 181134830 missense probably damaging 0.96
R0928:Nvl UTSW 1 181093902 missense probably benign 0.00
R1398:Nvl UTSW 1 181097126 splice site probably benign
R1470:Nvl UTSW 1 181139262 missense probably damaging 1.00
R1470:Nvl UTSW 1 181139262 missense probably damaging 1.00
R1529:Nvl UTSW 1 181109159 critical splice donor site probably null
R1934:Nvl UTSW 1 181099128 missense probably damaging 0.96
R2176:Nvl UTSW 1 181135074 splice site probably benign
R2351:Nvl UTSW 1 181130792 missense probably benign 0.03
R4415:Nvl UTSW 1 181105114 missense probably benign
R4570:Nvl UTSW 1 181144082 missense probably benign 0.03
R4720:Nvl UTSW 1 181101587 missense probably damaging 1.00
R4888:Nvl UTSW 1 181117626 missense probably damaging 1.00
R5026:Nvl UTSW 1 181105155 missense probably damaging 1.00
R5507:Nvl UTSW 1 181135036 missense probably damaging 0.98
R5785:Nvl UTSW 1 181139298 missense probably damaging 1.00
R5983:Nvl UTSW 1 181136906 missense probably benign 0.00
R6532:Nvl UTSW 1 181144143 splice site probably null
R6821:Nvl UTSW 1 181126970 nonsense probably null
R7062:Nvl UTSW 1 181112334 missense probably benign 0.19
R7247:Nvl UTSW 1 181112286 critical splice donor site probably null
R7358:Nvl UTSW 1 181135036 missense probably damaging 0.98
R7665:Nvl UTSW 1 181134944 missense probably benign 0.18
R7795:Nvl UTSW 1 181097157 missense probably benign 0.00
R7931:Nvl UTSW 1 181109155 splice site probably benign
R8185:Nvl UTSW 1 181144174 unclassified probably benign
R8806:Nvl UTSW 1 181095054 missense probably benign 0.01
X0067:Nvl UTSW 1 181139158 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TTGGTCATCTGATAGGTCCAAGG -3'
(R):5'- CCAAGAGTGGTTTAGTAGTTTCAG -3'

Sequencing Primer
(F):5'- TCTGATAGGTCCAAGGGAAGACTTTC -3'
(R):5'- GTTTGGGAGTTTTATAACTGACAACC -3'
Posted On2017-10-10