Incidental Mutation 'R6143:Sgk2'
ID488662
Institutional Source Beutler Lab
Gene Symbol Sgk2
Ensembl Gene ENSMUSG00000017868
Gene Nameserum/glucocorticoid regulated kinase 2
Synonyms
MMRRC Submission 044290-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6143 (G1)
Quality Score169.009
Status Validated
Chromosome2
Chromosomal Location162987330-163014127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 162999254 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 195 (C195S)
Ref Sequence ENSEMBL: ENSMUSP00000018012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018012] [ENSMUST00000117123]
Predicted Effect probably damaging
Transcript: ENSMUST00000018012
AA Change: C195S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018012
Gene: ENSMUSG00000017868
AA Change: C195S

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
S_TKc 35 292 4.09e-102 SMART
S_TK_X 293 359 8.21e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117123
SMART Domains Protein: ENSMUSP00000112468
Gene: ENSMUSG00000017868

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
S_TKc 35 263 2.24e-76 SMART
S_TK_X 264 330 8.21e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139053
Meta Mutation Damage Score 0.8024 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase. Although this gene product is similar to serum- and glucocorticoid-induced protein kinase (SGK), this gene is not induced by serum or glucocorticoids. This gene is induced in response to signals that activate phosphatidylinositol 3-kinase, which is also true for SGK. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730061H03Rik A G 14: 55,560,279 probably benign Het
Abcd2 A T 15: 91,190,947 V221E possibly damaging Het
Arhgap39 T A 15: 76,730,406 K853* probably null Het
Art2a-ps T C 7: 101,555,223 D36G possibly damaging Het
Atp13a1 C T 8: 69,805,360 P922S probably benign Het
Brwd1 C T 16: 96,002,956 G2005R probably benign Het
Bzw2 A T 12: 36,120,726 M133K probably benign Het
Cacna1s T G 1: 136,076,758 S346A probably damaging Het
Cebpb C A 2: 167,689,300 D93E probably benign Het
Cep162 C A 9: 87,212,851 probably null Het
Col9a2 A T 4: 121,053,863 Y565F probably damaging Het
Csgalnact1 T A 8: 68,373,550 N372I probably damaging Het
Csmd1 T C 8: 16,088,301 D1579G probably damaging Het
Cyfip2 A C 11: 46,253,965 Y687* probably null Het
Cyp2d34 G A 15: 82,620,776 R28W probably benign Het
Dbndd2 C A 2: 164,488,286 Q13K probably damaging Het
Dnah5 T A 15: 28,233,231 S245R probably benign Het
Dnajb5 A T 4: 42,956,990 T226S probably damaging Het
Dnmt1 T C 9: 20,927,134 E211G probably benign Het
Dnpep G A 1: 75,315,228 H214Y probably damaging Het
Drc3 G A 11: 60,370,580 V186M possibly damaging Het
Dvl3 A G 16: 20,527,039 D413G possibly damaging Het
Dyrk4 C T 6: 126,886,651 probably null Het
Edc4 T A 8: 105,885,874 D181E probably damaging Het
Enthd1 T C 15: 80,509,286 Y247C possibly damaging Het
Gm5622 A T 14: 51,654,915 R50S possibly damaging Het
Gpbp1 G A 13: 111,466,855 T20I probably damaging Het
Hnrnpdl A T 5: 100,036,551 Y276* probably null Het
Hsd3b7 A C 7: 127,801,232 E51A probably damaging Het
Ighv5-16 G T 12: 113,838,618 F87L probably damaging Het
Iqsec1 C T 6: 90,809,684 probably null Het
Irgm2 A T 11: 58,220,609 E387D possibly damaging Het
Klhl23 C A 2: 69,833,696 P463Q possibly damaging Het
Mast4 A T 13: 102,853,883 N43K probably damaging Het
Mme T G 3: 63,300,111 probably null Het
Mrps31 T G 8: 22,411,523 S20A probably benign Het
Myo5c A G 9: 75,249,809 R176G probably damaging Het
Naf1 T C 8: 66,877,695 V291A possibly damaging Het
Nbeal1 A T 1: 60,251,307 H1021L possibly damaging Het
Ncaph2 T C 15: 89,364,003 probably null Het
Neurod4 T G 10: 130,271,000 Y135S probably damaging Het
Nrp2 A T 1: 62,760,815 N396I probably damaging Het
Nvl T G 1: 181,134,995 T137P probably benign Het
Olfr483 A G 7: 108,104,128 D273G probably damaging Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pcdhgc4 T A 18: 37,817,600 S690T possibly damaging Het
Pck1 A T 2: 173,154,012 D101V probably damaging Het
Pdilt T A 7: 119,495,042 N329Y probably damaging Het
Pfkl T A 10: 77,989,613 R648W probably damaging Het
Prtn3 T A 10: 79,880,548 I63N probably damaging Het
Psg22 C T 7: 18,722,798 A163V probably benign Het
Pten A G 19: 32,800,085 T160A possibly damaging Het
Retreg2 A G 1: 75,146,886 D449G probably damaging Het
Scn9a T C 2: 66,487,524 Y1531C probably benign Het
Slc19a3 C T 1: 83,026,339 V14I probably benign Het
Snai2 A T 16: 14,708,243 R253* probably null Het
Speg G A 1: 75,414,387 V1512I probably damaging Het
Srsf1 G A 11: 88,049,599 probably benign Het
Tctn3 G T 19: 40,609,227 T190N probably benign Het
Tmprss11f T A 5: 86,539,699 I117L probably benign Het
Ttn G A 2: 76,852,069 R959* probably null Het
Vmn2r118 G T 17: 55,592,871 L678I possibly damaging Het
Vps13b T C 15: 35,668,738 S1594P probably damaging Het
Vps13d G T 4: 145,148,565 H1791N possibly damaging Het
Other mutations in Sgk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03048:Sgk2 UTSW 2 162995760 missense probably damaging 1.00
R0319:Sgk2 UTSW 2 162995672 splice site probably benign
R0563:Sgk2 UTSW 2 163004244 missense probably damaging 1.00
R0947:Sgk2 UTSW 2 163006838 missense probably benign 0.35
R1624:Sgk2 UTSW 2 162997859 missense probably benign 0.20
R1975:Sgk2 UTSW 2 163004160 missense probably benign
R1977:Sgk2 UTSW 2 163004160 missense probably benign
R2085:Sgk2 UTSW 2 163012970 missense probably damaging 1.00
R2136:Sgk2 UTSW 2 162999179 splice site probably null
R2873:Sgk2 UTSW 2 162994529 splice site probably benign
R2874:Sgk2 UTSW 2 162994529 splice site probably benign
R2919:Sgk2 UTSW 2 162999195 missense probably damaging 1.00
R2919:Sgk2 UTSW 2 162999205 missense probably damaging 1.00
R4602:Sgk2 UTSW 2 162994754 critical splice donor site probably null
R4660:Sgk2 UTSW 2 162997843 missense possibly damaging 0.95
R5517:Sgk2 UTSW 2 162997835 missense probably damaging 1.00
R5531:Sgk2 UTSW 2 162994704 missense probably benign 0.00
R7355:Sgk2 UTSW 2 163013067 missense probably benign 0.02
R7825:Sgk2 UTSW 2 163006881 missense possibly damaging 0.56
R7837:Sgk2 UTSW 2 163003296 missense probably damaging 1.00
R8796:Sgk2 UTSW 2 163006803 missense probably damaging 0.99
R8843:Sgk2 UTSW 2 163012970 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTGGGTCTGCATGAAGC -3'
(R):5'- TATTTCCACTGGGCAGCAGC -3'

Sequencing Primer
(F):5'- GCACGCAGCTTGTGTCTC -3'
(R):5'- CTGAAGTCACCAGAGGTAGCTG -3'
Posted On2017-10-10