Incidental Mutation 'R6143:Pck1'
ID488664
Institutional Source Beutler Lab
Gene Symbol Pck1
Ensembl Gene ENSMUSG00000027513
Gene Namephosphoenolpyruvate carboxykinase 1, cytosolic
SynonymsPEPCK, Pck-1
MMRRC Submission 044290-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6143 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location173153048-173159273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 173154012 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 101 (D101V)
Ref Sequence ENSEMBL: ENSMUSP00000029017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029017]
Predicted Effect probably damaging
Transcript: ENSMUST00000029017
AA Change: D101V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029017
Gene: ENSMUSG00000027513
AA Change: D101V

DomainStartEndE-ValueType
Pfam:PEPCK 29 619 3.2e-275 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151269
Meta Mutation Damage Score 0.7104 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a main control point for the regulation of gluconeogenesis. The cytosolic enzyme encoded by this gene, along with GTP, catalyzes the formation of phosphoenolpyruvate from oxaloacetate, with the release of carbon dioxide and GDP. The expression of this gene can be regulated by insulin, glucocorticoids, glucagon, cAMP, and diet. Defects in this gene are a cause of cytosolic phosphoenolpyruvate carboxykinase deficiency. A mitochondrial isozyme of the encoded protein also has been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit early postnatal lethality, decreased body fat, decreased glycogen levels in the liver, and altered blood chemistry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730061H03Rik A G 14: 55,560,279 probably benign Het
Abcd2 A T 15: 91,190,947 V221E possibly damaging Het
Arhgap39 T A 15: 76,730,406 K853* probably null Het
Art2a-ps T C 7: 101,555,223 D36G possibly damaging Het
Atp13a1 C T 8: 69,805,360 P922S probably benign Het
Brwd1 C T 16: 96,002,956 G2005R probably benign Het
Bzw2 A T 12: 36,120,726 M133K probably benign Het
Cacna1s T G 1: 136,076,758 S346A probably damaging Het
Cebpb C A 2: 167,689,300 D93E probably benign Het
Cep162 C A 9: 87,212,851 probably null Het
Col9a2 A T 4: 121,053,863 Y565F probably damaging Het
Csgalnact1 T A 8: 68,373,550 N372I probably damaging Het
Csmd1 T C 8: 16,088,301 D1579G probably damaging Het
Cyfip2 A C 11: 46,253,965 Y687* probably null Het
Cyp2d34 G A 15: 82,620,776 R28W probably benign Het
Dbndd2 C A 2: 164,488,286 Q13K probably damaging Het
Dnah5 T A 15: 28,233,231 S245R probably benign Het
Dnajb5 A T 4: 42,956,990 T226S probably damaging Het
Dnmt1 T C 9: 20,927,134 E211G probably benign Het
Dnpep G A 1: 75,315,228 H214Y probably damaging Het
Drc3 G A 11: 60,370,580 V186M possibly damaging Het
Dvl3 A G 16: 20,527,039 D413G possibly damaging Het
Dyrk4 C T 6: 126,886,651 probably null Het
Edc4 T A 8: 105,885,874 D181E probably damaging Het
Enthd1 T C 15: 80,509,286 Y247C possibly damaging Het
Gm5622 A T 14: 51,654,915 R50S possibly damaging Het
Gpbp1 G A 13: 111,466,855 T20I probably damaging Het
Hnrnpdl A T 5: 100,036,551 Y276* probably null Het
Hsd3b7 A C 7: 127,801,232 E51A probably damaging Het
Ighv5-16 G T 12: 113,838,618 F87L probably damaging Het
Iqsec1 C T 6: 90,809,684 probably null Het
Irgm2 A T 11: 58,220,609 E387D possibly damaging Het
Klhl23 C A 2: 69,833,696 P463Q possibly damaging Het
Mast4 A T 13: 102,853,883 N43K probably damaging Het
Mme T G 3: 63,300,111 probably null Het
Mrps31 T G 8: 22,411,523 S20A probably benign Het
Myo5c A G 9: 75,249,809 R176G probably damaging Het
Naf1 T C 8: 66,877,695 V291A possibly damaging Het
Nbeal1 A T 1: 60,251,307 H1021L possibly damaging Het
Ncaph2 T C 15: 89,364,003 probably null Het
Neurod4 T G 10: 130,271,000 Y135S probably damaging Het
Nrp2 A T 1: 62,760,815 N396I probably damaging Het
Nvl T G 1: 181,134,995 T137P probably benign Het
Olfr483 A G 7: 108,104,128 D273G probably damaging Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pcdhgc4 T A 18: 37,817,600 S690T possibly damaging Het
Pdilt T A 7: 119,495,042 N329Y probably damaging Het
Pfkl T A 10: 77,989,613 R648W probably damaging Het
Prtn3 T A 10: 79,880,548 I63N probably damaging Het
Psg22 C T 7: 18,722,798 A163V probably benign Het
Pten A G 19: 32,800,085 T160A possibly damaging Het
Retreg2 A G 1: 75,146,886 D449G probably damaging Het
Scn9a T C 2: 66,487,524 Y1531C probably benign Het
Sgk2 T A 2: 162,999,254 C195S probably damaging Het
Slc19a3 C T 1: 83,026,339 V14I probably benign Het
Snai2 A T 16: 14,708,243 R253* probably null Het
Speg G A 1: 75,414,387 V1512I probably damaging Het
Srsf1 G A 11: 88,049,599 probably benign Het
Tctn3 G T 19: 40,609,227 T190N probably benign Het
Tmprss11f T A 5: 86,539,699 I117L probably benign Het
Ttn G A 2: 76,852,069 R959* probably null Het
Vmn2r118 G T 17: 55,592,871 L678I possibly damaging Het
Vps13b T C 15: 35,668,738 S1594P probably damaging Het
Vps13d G T 4: 145,148,565 H1791N possibly damaging Het
Other mutations in Pck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Pck1 APN 2 173154118 critical splice donor site probably null
IGL00817:Pck1 APN 2 173153432 missense possibly damaging 0.47
IGL02476:Pck1 APN 2 173158282 missense probably benign
IGL02803:Pck1 APN 2 173156004 missense probably damaging 1.00
IGL02874:Pck1 APN 2 173155249 missense probably damaging 1.00
IGL02886:Pck1 APN 2 173154856 missense probably benign 0.43
Limestone UTSW 2 173158560 missense probably damaging 1.00
limpet UTSW 2 173154012 missense probably damaging 0.99
R0041:Pck1 UTSW 2 173155210 missense probably benign 0.21
R0125:Pck1 UTSW 2 173156081 nonsense probably null
R0238:Pck1 UTSW 2 173157068 missense possibly damaging 0.91
R0238:Pck1 UTSW 2 173157068 missense possibly damaging 0.91
R0373:Pck1 UTSW 2 173153390 start codon destroyed probably null 0.99
R0595:Pck1 UTSW 2 173157029 missense probably damaging 1.00
R1338:Pck1 UTSW 2 173158410 missense probably benign 0.18
R1623:Pck1 UTSW 2 173154718 missense probably benign 0.26
R1752:Pck1 UTSW 2 173157113 missense probably benign 0.00
R2107:Pck1 UTSW 2 173154068 missense probably benign 0.00
R2376:Pck1 UTSW 2 173157116 missense probably benign
R2883:Pck1 UTSW 2 173158575 missense probably benign 0.03
R3508:Pck1 UTSW 2 173158384 missense possibly damaging 0.61
R4718:Pck1 UTSW 2 173155221 missense probably damaging 0.99
R4853:Pck1 UTSW 2 173154714 nonsense probably null
R4907:Pck1 UTSW 2 173157023 missense probably damaging 1.00
R4950:Pck1 UTSW 2 173154827 missense probably benign
R5073:Pck1 UTSW 2 173156977 missense probably benign 0.41
R5134:Pck1 UTSW 2 173153489 missense probably benign 0.23
R5213:Pck1 UTSW 2 173156085 nonsense probably null
R5244:Pck1 UTSW 2 173154863 missense possibly damaging 0.91
R5654:Pck1 UTSW 2 173158560 missense probably damaging 1.00
R5831:Pck1 UTSW 2 173156999 missense probably damaging 1.00
R6030:Pck1 UTSW 2 173154857 missense probably benign 0.40
R6030:Pck1 UTSW 2 173154857 missense probably benign 0.40
R6276:Pck1 UTSW 2 173157319 missense probably damaging 1.00
R7553:Pck1 UTSW 2 173157067 missense probably benign 0.13
R7860:Pck1 UTSW 2 173155950 missense possibly damaging 0.80
R8076:Pck1 UTSW 2 173155278 missense probably damaging 1.00
R8187:Pck1 UTSW 2 173155240 missense probably benign 0.23
R8523:Pck1 UTSW 2 173157271 missense probably damaging 1.00
R8729:Pck1 UTSW 2 173156073 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCAACTCCTTTCCCCAGG -3'
(R):5'- GGTCGCCATTAGGAACATGAAC -3'

Sequencing Primer
(F):5'- GCCAGGTCACAGTCTAGCTAATGTC -3'
(R):5'- CGCCATTAGGAACATGAACTATGTAC -3'
Posted On2017-10-10