Mutagenetix > Incidental Mutation

Incidental Mutation 'R6143:Col9a2'

488666

Institutional Source

Beutler Lab

Gene Symbol

Col9a2

Ensembl Gene

ENSMUSG00000028626

Gene Name

collagen, type IX, alpha 2

Synonyms

Col9a-2

MMRRC Submission

044290-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6143 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121039385-121055322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 121053863 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 565 (Y565F)

Ref Sequence

ENSEMBL: ENSMUSP00000030372 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030372]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000030372
AA Change: Y565F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: Y565F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Collagen	24	82	7.3e-12	PFAM
Pfam:Collagen	59	115	2.4e-10	PFAM
Pfam:Collagen	113	170	2e-8	PFAM
Pfam:Collagen	176	236	8.9e-11	PFAM
low complexity region	258	277	N/A	INTRINSIC
low complexity region	288	315	N/A	INTRINSIC
Pfam:Collagen	357	435	4.4e-8	PFAM
Pfam:Collagen	459	523	6.1e-11	PFAM
Pfam:Collagen	548	610	4.5e-11	PFAM
low complexity region	639	661	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140119

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.1%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730061H03Rik	A	G	14: 55,560,279		probably benign	Het
Abcd2	A	T	15: 91,190,947	V221E	possibly damaging	Het
Arhgap39	T	A	15: 76,730,406	K853*	probably null	Het
Art2a-ps	T	C	7: 101,555,223	D36G	possibly damaging	Het
Atp13a1	C	T	8: 69,805,360	P922S	probably benign	Het
Brwd1	C	T	16: 96,002,956	G2005R	probably benign	Het
Bzw2	A	T	12: 36,120,726	M133K	probably benign	Het
Cacna1s	T	G	1: 136,076,758	S346A	probably damaging	Het
Cebpb	C	A	2: 167,689,300	D93E	probably benign	Het
Cep162	C	A	9: 87,212,851		probably null	Het
Csgalnact1	T	A	8: 68,373,550	N372I	probably damaging	Het
Csmd1	T	C	8: 16,088,301	D1579G	probably damaging	Het
Cyfip2	A	C	11: 46,253,965	Y687*	probably null	Het
Cyp2d34	G	A	15: 82,620,776	R28W	probably benign	Het
Dbndd2	C	A	2: 164,488,286	Q13K	probably damaging	Het
Dnah5	T	A	15: 28,233,231	S245R	probably benign	Het
Dnajb5	A	T	4: 42,956,990	T226S	probably damaging	Het
Dnmt1	T	C	9: 20,927,134	E211G	probably benign	Het
Dnpep	G	A	1: 75,315,228	H214Y	probably damaging	Het
Drc3	G	A	11: 60,370,580	V186M	possibly damaging	Het
Dvl3	A	G	16: 20,527,039	D413G	possibly damaging	Het
Dyrk4	C	T	6: 126,886,651		probably null	Het
Edc4	T	A	8: 105,885,874	D181E	probably damaging	Het
Enthd1	T	C	15: 80,509,286	Y247C	possibly damaging	Het
Gm5622	A	T	14: 51,654,915	R50S	possibly damaging	Het
Gpbp1	G	A	13: 111,466,855	T20I	probably damaging	Het
Hnrnpdl	A	T	5: 100,036,551	Y276*	probably null	Het
Hsd3b7	A	C	7: 127,801,232	E51A	probably damaging	Het
Ighv5-16	G	T	12: 113,838,618	F87L	probably damaging	Het
Iqsec1	C	T	6: 90,809,684		probably null	Het
Irgm2	A	T	11: 58,220,609	E387D	possibly damaging	Het
Klhl23	C	A	2: 69,833,696	P463Q	possibly damaging	Het
Mast4	A	T	13: 102,853,883	N43K	probably damaging	Het
Mme	T	G	3: 63,300,111		probably null	Het
Mrps31	T	G	8: 22,411,523	S20A	probably benign	Het
Myo5c	A	G	9: 75,249,809	R176G	probably damaging	Het
Naf1	T	C	8: 66,877,695	V291A	possibly damaging	Het
Nbeal1	A	T	1: 60,251,307	H1021L	possibly damaging	Het
Ncaph2	T	C	15: 89,364,003		probably null	Het
Neurod4	T	G	10: 130,271,000	Y135S	probably damaging	Het
Nrp2	A	T	1: 62,760,815	N396I	probably damaging	Het
Nvl	T	G	1: 181,134,995	T137P	probably benign	Het
Olfr483	A	G	7: 108,104,128	D273G	probably damaging	Het
Papola	T	C	12: 105,826,960	V513A	probably benign	Het
Pcdhgc4	T	A	18: 37,817,600	S690T	possibly damaging	Het
Pck1	A	T	2: 173,154,012	D101V	probably damaging	Het
Pdilt	T	A	7: 119,495,042	N329Y	probably damaging	Het
Pfkl	T	A	10: 77,989,613	R648W	probably damaging	Het
Prtn3	T	A	10: 79,880,548	I63N	probably damaging	Het
Psg22	C	T	7: 18,722,798	A163V	probably benign	Het
Pten	A	G	19: 32,800,085	T160A	possibly damaging	Het
Retreg2	A	G	1: 75,146,886	D449G	probably damaging	Het
Scn9a	T	C	2: 66,487,524	Y1531C	probably benign	Het
Sgk2	T	A	2: 162,999,254	C195S	probably damaging	Het
Slc19a3	C	T	1: 83,026,339	V14I	probably benign	Het
Snai2	A	T	16: 14,708,243	R253*	probably null	Het
Speg	G	A	1: 75,414,387	V1512I	probably damaging	Het
Srsf1	G	A	11: 88,049,599		probably benign	Het
Tctn3	G	T	19: 40,609,227	T190N	probably benign	Het
Tmprss11f	T	A	5: 86,539,699	I117L	probably benign	Het
Ttn	G	A	2: 76,852,069	R959*	probably null	Het
Vmn2r118	G	T	17: 55,592,871	L678I	possibly damaging	Het
Vps13b	T	C	15: 35,668,738	S1594P	probably damaging	Het
Vps13d	G	T	4: 145,148,565	H1791N	possibly damaging	Het

Other mutations in Col9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01331:Col9a2	APN	4	121045192	missense	possibly damaging	0.95
IGL01978:Col9a2	APN	4	121044666	missense	unknown
IGL01995:Col9a2	APN	4	121050410	critical splice donor site	probably null
IGL02162:Col9a2	APN	4	121054334	unclassified	probably benign
IGL02931:Col9a2	APN	4	121053192	missense	probably benign	0.06
collision	UTSW	4	121049716	critical splice donor site	probably null
gravity_wave	UTSW	4	121044019	critical splice donor site	probably null
R0208:Col9a2	UTSW	4	121052288	splice site	probably benign
R0426:Col9a2	UTSW	4	121044660	splice site	probably benign
R0512:Col9a2	UTSW	4	121054307	missense	probably benign	0.22
R0973:Col9a2	UTSW	4	121039788	critical splice donor site	probably null
R1023:Col9a2	UTSW	4	121044010	missense	unknown
R1657:Col9a2	UTSW	4	121040974	missense	unknown
R1724:Col9a2	UTSW	4	121053902	missense	probably damaging	1.00
R2171:Col9a2	UTSW	4	121045001	nonsense	probably null
R2206:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2221:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2223:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2273:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2274:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2275:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2354:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2392:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2393:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2394:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3421:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3426:Col9a2	UTSW	4	121050407	missense	possibly damaging	0.93
R3710:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3821:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3838:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3839:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4067:Col9a2	UTSW	4	121052389	missense	probably damaging	1.00
R4298:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4299:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4595:Col9a2	UTSW	4	121045155	missense	probably benign	0.04
R4942:Col9a2	UTSW	4	121053119	missense	possibly damaging	0.73
R5120:Col9a2	UTSW	4	121039772	missense	unknown
R5434:Col9a2	UTSW	4	121040965	nonsense	probably null
R7027:Col9a2	UTSW	4	121044019	critical splice donor site	probably null
R7056:Col9a2	UTSW	4	121049716	critical splice donor site	probably null
R7417:Col9a2	UTSW	4	121054292	missense	not run
R7571:Col9a2	UTSW	4	121039784	missense	unknown
R9120:Col9a2	UTSW	4	121043754	splice site	probably benign
R9341:Col9a2	UTSW	4	121054286	missense	probably benign	0.03
R9343:Col9a2	UTSW	4	121054286	missense	probably benign	0.03
R9389:Col9a2	UTSW	4	121054751	missense	probably benign	0.00
R9527:Col9a2	UTSW	4	121042331	critical splice donor site	probably null
R9620:Col9a2	UTSW	4	121053206	critical splice donor site	probably null
R9784:Col9a2	UTSW	4	121041029	missense	unknown
Z1176:Col9a2	UTSW	4	121053797	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCTACATTCGTATGGCCAGG -3'
(R):5'- GGAGGTTCTGTATCCGATAAGG -3'

Sequencing Primer
(F):5'- ATTCGTATGGCCAGGATGCAC -3'
(R):5'- ACTGGCATTTACTATGTACCAAGCTG -3'

Posted On

2017-10-10