Incidental Mutation 'R6143:Hsd3b7'
ID488675
Institutional Source Beutler Lab
Gene Symbol Hsd3b7
Ensembl Gene ENSMUSG00000042289
Gene Namehydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
Synonyms
MMRRC Submission 044290-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6143 (G1)
Quality Score220.009
Status Validated
Chromosome7
Chromosomal Location127800604-127803802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 127801232 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 51 (E51A)
Ref Sequence ENSEMBL: ENSMUSP00000146308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046863] [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000106267] [ENSMUST00000106271] [ENSMUST00000106272] [ENSMUST00000125188] [ENSMUST00000138432] [ENSMUST00000139068] [ENSMUST00000154987] [ENSMUST00000155005] [ENSMUST00000206674]
Predicted Effect probably benign
Transcript: ENSMUST00000046863
AA Change: E51A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000036245
Gene: ENSMUSG00000042289
AA Change: E51A

DomainStartEndE-ValueType
Pfam:KR 11 147 3e-10 PFAM
Pfam:RmlD_sub_bind 11 198 8.1e-10 PFAM
Pfam:Polysacc_synt_2 12 140 4.6e-13 PFAM
Pfam:NmrA 12 142 1.9e-9 PFAM
Pfam:Epimerase 12 215 3.2e-25 PFAM
Pfam:GDP_Man_Dehyd 13 185 8.1e-17 PFAM
Pfam:3Beta_HSD 13 290 5.4e-99 PFAM
Pfam:NAD_binding_4 14 240 1.4e-15 PFAM
transmembrane domain 312 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047075
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047157
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106267
SMART Domains Protein: ENSMUSP00000101874
Gene: ENSMUSG00000030806

DomainStartEndE-ValueType
SynN 24 145 1.99e-44 SMART
t_SNARE 186 253 4.32e-24 SMART
transmembrane domain 265 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106271
AA Change: E51A

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101878
Gene: ENSMUSG00000042289
AA Change: E51A

DomainStartEndE-ValueType
Pfam:adh_short 10 143 1.3e-13 PFAM
Pfam:RmlD_sub_bind 10 186 3.7e-10 PFAM
Pfam:KR 11 140 5.7e-10 PFAM
Pfam:Polysacc_synt_2 12 140 2.8e-13 PFAM
Pfam:NmrA 12 141 2.7e-9 PFAM
Pfam:Epimerase 12 220 2.9e-26 PFAM
Pfam:NAD_binding_10 13 186 2.3e-11 PFAM
Pfam:3Beta_HSD 13 216 1e-70 PFAM
Pfam:NAD_binding_4 14 183 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106272
AA Change: E51A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101879
Gene: ENSMUSG00000042289
AA Change: E51A

DomainStartEndE-ValueType
Pfam:adh_short 10 143 3.7e-13 PFAM
Pfam:RmlD_sub_bind 10 180 2.8e-9 PFAM
Pfam:KR 11 139 1.6e-9 PFAM
Pfam:Polysacc_synt_2 12 140 7.7e-13 PFAM
Pfam:NmrA 12 141 7.3e-9 PFAM
Pfam:Epimerase 12 215 7.1e-26 PFAM
Pfam:NAD_binding_10 13 179 1.1e-10 PFAM
Pfam:3Beta_HSD 13 188 6.1e-70 PFAM
Pfam:NAD_binding_4 14 187 1.5e-17 PFAM
Pfam:3Beta_HSD 177 261 4e-23 PFAM
transmembrane domain 281 303 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124631
Predicted Effect probably benign
Transcript: ENSMUST00000125188
AA Change: E24A

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136597
Predicted Effect probably benign
Transcript: ENSMUST00000136823
Predicted Effect probably damaging
Transcript: ENSMUST00000138432
AA Change: E54A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114536
Gene: ENSMUSG00000042289
AA Change: E54A

DomainStartEndE-ValueType
Pfam:3Beta_HSD 18 78 1.3e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000139068
AA Change: E51A

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121246
Gene: ENSMUSG00000042289
AA Change: E51A

DomainStartEndE-ValueType
Pfam:3Beta_HSD 13 55 2.7e-13 PFAM
Pfam:3Beta_HSD 53 100 3.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144748
Predicted Effect probably benign
Transcript: ENSMUST00000154987
Predicted Effect probably damaging
Transcript: ENSMUST00000155005
AA Change: E51A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206516
Predicted Effect probably damaging
Transcript: ENSMUST00000206674
AA Change: E51A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206995
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which is involved in the initial stages of the synthesis of bile acids from cholesterol and a member of the short-chain dehydrogenase/reductase superfamily. The encoded protein is a membrane-associated endoplasmic reticulum protein which is active against 7-alpha hydrosylated sterol substrates. Mutations in this gene are associated with a congenital bile acid synthesis defect which leads to neonatal cholestasis, a form of progressive liver disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, dwarfism, growth retardation, oily and scaly skin, and altered bile salt and lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730061H03Rik A G 14: 55,560,279 probably benign Het
Abcd2 A T 15: 91,190,947 V221E possibly damaging Het
Arhgap39 T A 15: 76,730,406 K853* probably null Het
Art2a-ps T C 7: 101,555,223 D36G possibly damaging Het
Atp13a1 C T 8: 69,805,360 P922S probably benign Het
Brwd1 C T 16: 96,002,956 G2005R probably benign Het
Bzw2 A T 12: 36,120,726 M133K probably benign Het
Cacna1s T G 1: 136,076,758 S346A probably damaging Het
Cebpb C A 2: 167,689,300 D93E probably benign Het
Cep162 C A 9: 87,212,851 probably null Het
Col9a2 A T 4: 121,053,863 Y565F probably damaging Het
Csgalnact1 T A 8: 68,373,550 N372I probably damaging Het
Csmd1 T C 8: 16,088,301 D1579G probably damaging Het
Cyfip2 A C 11: 46,253,965 Y687* probably null Het
Cyp2d34 G A 15: 82,620,776 R28W probably benign Het
Dbndd2 C A 2: 164,488,286 Q13K probably damaging Het
Dnah5 T A 15: 28,233,231 S245R probably benign Het
Dnajb5 A T 4: 42,956,990 T226S probably damaging Het
Dnmt1 T C 9: 20,927,134 E211G probably benign Het
Dnpep G A 1: 75,315,228 H214Y probably damaging Het
Drc3 G A 11: 60,370,580 V186M possibly damaging Het
Dvl3 A G 16: 20,527,039 D413G possibly damaging Het
Dyrk4 C T 6: 126,886,651 probably null Het
Edc4 T A 8: 105,885,874 D181E probably damaging Het
Enthd1 T C 15: 80,509,286 Y247C possibly damaging Het
Gm5622 A T 14: 51,654,915 R50S possibly damaging Het
Gpbp1 G A 13: 111,466,855 T20I probably damaging Het
Hnrnpdl A T 5: 100,036,551 Y276* probably null Het
Ighv5-16 G T 12: 113,838,618 F87L probably damaging Het
Iqsec1 C T 6: 90,809,684 probably null Het
Irgm2 A T 11: 58,220,609 E387D possibly damaging Het
Klhl23 C A 2: 69,833,696 P463Q possibly damaging Het
Mast4 A T 13: 102,853,883 N43K probably damaging Het
Mme T G 3: 63,300,111 probably null Het
Mrps31 T G 8: 22,411,523 S20A probably benign Het
Myo5c A G 9: 75,249,809 R176G probably damaging Het
Naf1 T C 8: 66,877,695 V291A possibly damaging Het
Nbeal1 A T 1: 60,251,307 H1021L possibly damaging Het
Ncaph2 T C 15: 89,364,003 probably null Het
Neurod4 T G 10: 130,271,000 Y135S probably damaging Het
Nrp2 A T 1: 62,760,815 N396I probably damaging Het
Nvl T G 1: 181,134,995 T137P probably benign Het
Olfr483 A G 7: 108,104,128 D273G probably damaging Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pcdhgc4 T A 18: 37,817,600 S690T possibly damaging Het
Pck1 A T 2: 173,154,012 D101V probably damaging Het
Pdilt T A 7: 119,495,042 N329Y probably damaging Het
Pfkl T A 10: 77,989,613 R648W probably damaging Het
Prtn3 T A 10: 79,880,548 I63N probably damaging Het
Psg22 C T 7: 18,722,798 A163V probably benign Het
Pten A G 19: 32,800,085 T160A possibly damaging Het
Retreg2 A G 1: 75,146,886 D449G probably damaging Het
Scn9a T C 2: 66,487,524 Y1531C probably benign Het
Sgk2 T A 2: 162,999,254 C195S probably damaging Het
Slc19a3 C T 1: 83,026,339 V14I probably benign Het
Snai2 A T 16: 14,708,243 R253* probably null Het
Speg G A 1: 75,414,387 V1512I probably damaging Het
Srsf1 G A 11: 88,049,599 probably benign Het
Tctn3 G T 19: 40,609,227 T190N probably benign Het
Tmprss11f T A 5: 86,539,699 I117L probably benign Het
Ttn G A 2: 76,852,069 R959* probably null Het
Vmn2r118 G T 17: 55,592,871 L678I possibly damaging Het
Vps13b T C 15: 35,668,738 S1594P probably damaging Het
Vps13d G T 4: 145,148,565 H1791N possibly damaging Het
Other mutations in Hsd3b7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Hsd3b7 APN 7 127802972 missense probably damaging 1.00
IGL01589:Hsd3b7 APN 7 127802864 missense probably damaging 1.00
IGL03037:Hsd3b7 APN 7 127801150 missense probably damaging 1.00
irritated UTSW 7 127801134 nonsense probably null
R0518:Hsd3b7 UTSW 7 127803079 missense probably benign 0.01
R1801:Hsd3b7 UTSW 7 127803034 missense possibly damaging 0.82
R2860:Hsd3b7 UTSW 7 127802270 missense probably damaging 1.00
R2861:Hsd3b7 UTSW 7 127802270 missense probably damaging 1.00
R4059:Hsd3b7 UTSW 7 127801545 missense probably damaging 1.00
R5129:Hsd3b7 UTSW 7 127801134 nonsense probably null
R5497:Hsd3b7 UTSW 7 127801888 missense probably damaging 1.00
R6358:Hsd3b7 UTSW 7 127801537 missense probably damaging 0.96
R6984:Hsd3b7 UTSW 7 127801545 missense probably damaging 1.00
R7067:Hsd3b7 UTSW 7 127800716 critical splice donor site probably null
R7910:Hsd3b7 UTSW 7 127801247 critical splice donor site probably null
R7991:Hsd3b7 UTSW 7 127801247 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGATCCCTTCTATGAAGAACACATGG -3'
(R):5'- TGAGTTTGGCCTGTCCACAC -3'

Sequencing Primer
(F):5'- TGCTACCAGGCAATTCTAGTGAGC -3'
(R):5'- CACCCTGGAAGCCACATG -3'
Posted On2017-10-10