Incidental Mutation 'R6143:Mrps31'
ID488677
Institutional Source Beutler Lab
Gene Symbol Mrps31
Ensembl Gene ENSMUSG00000031533
Gene Namemitochondrial ribosomal protein S31
SynonymsImogen44, 1500002D03Rik
MMRRC Submission 044290-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R6143 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location22411361-22429665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 22411523 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 20 (S20A)
Ref Sequence ENSEMBL: ENSMUSP00000033934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033934]
Predicted Effect probably benign
Transcript: ENSMUST00000033934
AA Change: S20A

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033934
Gene: ENSMUSG00000031533
AA Change: S20A

DomainStartEndE-ValueType
Pfam:MRP-S31 85 378 3.8e-118 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211758
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. The 28S subunit of the mammalian mitoribosome may play a crucial and characteristic role in translation initiation. This gene encodes a 28S subunit protein that has also been associated with type 1 diabetes; however, its relationship to the etiology of this disease remains to be clarified. Pseudogenes corresponding to this gene have been found on chromosomes 3 and 13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730061H03Rik A G 14: 55,560,279 probably benign Het
Abcd2 A T 15: 91,190,947 V221E possibly damaging Het
Arhgap39 T A 15: 76,730,406 K853* probably null Het
Art2a-ps T C 7: 101,555,223 D36G possibly damaging Het
Atp13a1 C T 8: 69,805,360 P922S probably benign Het
Brwd1 C T 16: 96,002,956 G2005R probably benign Het
Bzw2 A T 12: 36,120,726 M133K probably benign Het
Cacna1s T G 1: 136,076,758 S346A probably damaging Het
Cebpb C A 2: 167,689,300 D93E probably benign Het
Cep162 C A 9: 87,212,851 probably null Het
Col9a2 A T 4: 121,053,863 Y565F probably damaging Het
Csgalnact1 T A 8: 68,373,550 N372I probably damaging Het
Csmd1 T C 8: 16,088,301 D1579G probably damaging Het
Cyfip2 A C 11: 46,253,965 Y687* probably null Het
Cyp2d34 G A 15: 82,620,776 R28W probably benign Het
Dbndd2 C A 2: 164,488,286 Q13K probably damaging Het
Dnah5 T A 15: 28,233,231 S245R probably benign Het
Dnajb5 A T 4: 42,956,990 T226S probably damaging Het
Dnmt1 T C 9: 20,927,134 E211G probably benign Het
Dnpep G A 1: 75,315,228 H214Y probably damaging Het
Drc3 G A 11: 60,370,580 V186M possibly damaging Het
Dvl3 A G 16: 20,527,039 D413G possibly damaging Het
Dyrk4 C T 6: 126,886,651 probably null Het
Edc4 T A 8: 105,885,874 D181E probably damaging Het
Enthd1 T C 15: 80,509,286 Y247C possibly damaging Het
Gm5622 A T 14: 51,654,915 R50S possibly damaging Het
Gpbp1 G A 13: 111,466,855 T20I probably damaging Het
Hnrnpdl A T 5: 100,036,551 Y276* probably null Het
Hsd3b7 A C 7: 127,801,232 E51A probably damaging Het
Ighv5-16 G T 12: 113,838,618 F87L probably damaging Het
Iqsec1 C T 6: 90,809,684 probably null Het
Irgm2 A T 11: 58,220,609 E387D possibly damaging Het
Klhl23 C A 2: 69,833,696 P463Q possibly damaging Het
Mast4 A T 13: 102,853,883 N43K probably damaging Het
Mme T G 3: 63,300,111 probably null Het
Myo5c A G 9: 75,249,809 R176G probably damaging Het
Naf1 T C 8: 66,877,695 V291A possibly damaging Het
Nbeal1 A T 1: 60,251,307 H1021L possibly damaging Het
Ncaph2 T C 15: 89,364,003 probably null Het
Neurod4 T G 10: 130,271,000 Y135S probably damaging Het
Nrp2 A T 1: 62,760,815 N396I probably damaging Het
Nvl T G 1: 181,134,995 T137P probably benign Het
Olfr483 A G 7: 108,104,128 D273G probably damaging Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pcdhgc4 T A 18: 37,817,600 S690T possibly damaging Het
Pck1 A T 2: 173,154,012 D101V probably damaging Het
Pdilt T A 7: 119,495,042 N329Y probably damaging Het
Pfkl T A 10: 77,989,613 R648W probably damaging Het
Prtn3 T A 10: 79,880,548 I63N probably damaging Het
Psg22 C T 7: 18,722,798 A163V probably benign Het
Pten A G 19: 32,800,085 T160A possibly damaging Het
Retreg2 A G 1: 75,146,886 D449G probably damaging Het
Scn9a T C 2: 66,487,524 Y1531C probably benign Het
Sgk2 T A 2: 162,999,254 C195S probably damaging Het
Slc19a3 C T 1: 83,026,339 V14I probably benign Het
Snai2 A T 16: 14,708,243 R253* probably null Het
Speg G A 1: 75,414,387 V1512I probably damaging Het
Srsf1 G A 11: 88,049,599 probably benign Het
Tctn3 G T 19: 40,609,227 T190N probably benign Het
Tmprss11f T A 5: 86,539,699 I117L probably benign Het
Ttn G A 2: 76,852,069 R959* probably null Het
Vmn2r118 G T 17: 55,592,871 L678I possibly damaging Het
Vps13b T C 15: 35,668,738 S1594P probably damaging Het
Vps13d G T 4: 145,148,565 H1791N possibly damaging Het
Other mutations in Mrps31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Mrps31 APN 8 22429190 missense probably damaging 1.00
IGL00909:Mrps31 APN 8 22427825 missense probably damaging 1.00
IGL01818:Mrps31 APN 8 22411467 start codon destroyed probably null 1.00
R0304:Mrps31 UTSW 8 22421338 missense probably benign 0.06
R1230:Mrps31 UTSW 8 22419743 missense possibly damaging 0.60
R4702:Mrps31 UTSW 8 22419738 missense probably damaging 1.00
R5947:Mrps31 UTSW 8 22414975 missense possibly damaging 0.95
R6473:Mrps31 UTSW 8 22414865 missense probably benign 0.01
R7404:Mrps31 UTSW 8 22421413 missense probably benign 0.28
R7554:Mrps31 UTSW 8 22421429 missense possibly damaging 0.79
R7877:Mrps31 UTSW 8 22424351 missense probably benign
RF007:Mrps31 UTSW 8 22419864 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTACCGGAATCCAAAAGGAGCG -3'
(R):5'- TTCGAACAACCGCTTCCAAG -3'

Sequencing Primer
(F):5'- CGGAACAGTGCAGGCTG -3'
(R):5'- GCTTCCAAGAGCCTACGC -3'
Posted On2017-10-10