Incidental Mutation 'R6143:Neurod4'
ID488688
Institutional Source Beutler Lab
Gene Symbol Neurod4
Ensembl Gene ENSMUSG00000048015
Gene Nameneurogenic differentiation 4
SynonymsbHLHa4, MATH-3, Atoh3, Math3
MMRRC Submission 044290-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.640) question?
Stock #R6143 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location130268152-130280240 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 130271000 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 135 (Y135S)
Ref Sequence ENSEMBL: ENSMUSP00000051379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061571]
Predicted Effect probably damaging
Transcript: ENSMUST00000061571
AA Change: Y135S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051379
Gene: ENSMUSG00000048015
AA Change: Y135S

DomainStartEndE-ValueType
low complexity region 49 76 N/A INTRINSIC
HLH 93 145 2.21e-16 SMART
Pfam:Neuro_bHLH 146 263 1.3e-41 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: This gene belongs to the neurogenic differentiation factor family and encodes a basic helix-loop-helix (bHLH) transcription factor which is expressed in the developing nervous system with high levels of expression in the brain, retina and cranial ganglions. Expression gradually becomes restricted to the neural retina. It is a key gene in the Ngn2-regulated neuronal differentiation pathway, coordinating the onset of cortical gene transcription. This gene also regulates amacrine cell fate determination in the retina. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, ataxia, and high postnatal mortality. Mutants show impaired postnatal cerebellar development, with thinner inner granular cell and molecular layers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730061H03Rik A G 14: 55,560,279 probably benign Het
Abcd2 A T 15: 91,190,947 V221E possibly damaging Het
Arhgap39 T A 15: 76,730,406 K853* probably null Het
Art2a-ps T C 7: 101,555,223 D36G possibly damaging Het
Atp13a1 C T 8: 69,805,360 P922S probably benign Het
Brwd1 C T 16: 96,002,956 G2005R probably benign Het
Bzw2 A T 12: 36,120,726 M133K probably benign Het
Cacna1s T G 1: 136,076,758 S346A probably damaging Het
Cebpb C A 2: 167,689,300 D93E probably benign Het
Cep162 C A 9: 87,212,851 probably null Het
Col9a2 A T 4: 121,053,863 Y565F probably damaging Het
Csgalnact1 T A 8: 68,373,550 N372I probably damaging Het
Csmd1 T C 8: 16,088,301 D1579G probably damaging Het
Cyfip2 A C 11: 46,253,965 Y687* probably null Het
Cyp2d34 G A 15: 82,620,776 R28W probably benign Het
Dbndd2 C A 2: 164,488,286 Q13K probably damaging Het
Dnah5 T A 15: 28,233,231 S245R probably benign Het
Dnajb5 A T 4: 42,956,990 T226S probably damaging Het
Dnmt1 T C 9: 20,927,134 E211G probably benign Het
Dnpep G A 1: 75,315,228 H214Y probably damaging Het
Drc3 G A 11: 60,370,580 V186M possibly damaging Het
Dvl3 A G 16: 20,527,039 D413G possibly damaging Het
Dyrk4 C T 6: 126,886,651 probably null Het
Edc4 T A 8: 105,885,874 D181E probably damaging Het
Enthd1 T C 15: 80,509,286 Y247C possibly damaging Het
Gm5622 A T 14: 51,654,915 R50S possibly damaging Het
Gpbp1 G A 13: 111,466,855 T20I probably damaging Het
Hnrnpdl A T 5: 100,036,551 Y276* probably null Het
Hsd3b7 A C 7: 127,801,232 E51A probably damaging Het
Ighv5-16 G T 12: 113,838,618 F87L probably damaging Het
Iqsec1 C T 6: 90,809,684 probably null Het
Irgm2 A T 11: 58,220,609 E387D possibly damaging Het
Klhl23 C A 2: 69,833,696 P463Q possibly damaging Het
Mast4 A T 13: 102,853,883 N43K probably damaging Het
Mme T G 3: 63,300,111 probably null Het
Mrps31 T G 8: 22,411,523 S20A probably benign Het
Myo5c A G 9: 75,249,809 R176G probably damaging Het
Naf1 T C 8: 66,877,695 V291A possibly damaging Het
Nbeal1 A T 1: 60,251,307 H1021L possibly damaging Het
Ncaph2 T C 15: 89,364,003 probably null Het
Nrp2 A T 1: 62,760,815 N396I probably damaging Het
Nvl T G 1: 181,134,995 T137P probably benign Het
Olfr483 A G 7: 108,104,128 D273G probably damaging Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pcdhgc4 T A 18: 37,817,600 S690T possibly damaging Het
Pck1 A T 2: 173,154,012 D101V probably damaging Het
Pdilt T A 7: 119,495,042 N329Y probably damaging Het
Pfkl T A 10: 77,989,613 R648W probably damaging Het
Prtn3 T A 10: 79,880,548 I63N probably damaging Het
Psg22 C T 7: 18,722,798 A163V probably benign Het
Pten A G 19: 32,800,085 T160A possibly damaging Het
Retreg2 A G 1: 75,146,886 D449G probably damaging Het
Scn9a T C 2: 66,487,524 Y1531C probably benign Het
Sgk2 T A 2: 162,999,254 C195S probably damaging Het
Slc19a3 C T 1: 83,026,339 V14I probably benign Het
Snai2 A T 16: 14,708,243 R253* probably null Het
Speg G A 1: 75,414,387 V1512I probably damaging Het
Srsf1 G A 11: 88,049,599 probably benign Het
Tctn3 G T 19: 40,609,227 T190N probably benign Het
Tmprss11f T A 5: 86,539,699 I117L probably benign Het
Ttn G A 2: 76,852,069 R959* probably null Het
Vmn2r118 G T 17: 55,592,871 L678I possibly damaging Het
Vps13b T C 15: 35,668,738 S1594P probably damaging Het
Vps13d G T 4: 145,148,565 H1791N possibly damaging Het
Other mutations in Neurod4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Neurod4 APN 10 130270814 missense probably damaging 0.96
IGL01674:Neurod4 APN 10 130271018 missense probably damaging 1.00
R0347:Neurod4 UTSW 10 130271111 missense probably damaging 1.00
R1436:Neurod4 UTSW 10 130270671 missense possibly damaging 0.87
R1467:Neurod4 UTSW 10 130270604 missense probably benign 0.03
R1467:Neurod4 UTSW 10 130270604 missense probably benign 0.03
R1965:Neurod4 UTSW 10 130271049 nonsense probably null
R3018:Neurod4 UTSW 10 130270955 missense probably damaging 1.00
R3847:Neurod4 UTSW 10 130270482 missense probably benign
R5491:Neurod4 UTSW 10 130271067 missense possibly damaging 0.95
R5655:Neurod4 UTSW 10 130271133 nonsense probably null
R5705:Neurod4 UTSW 10 130271402 start codon destroyed probably null 0.99
R6800:Neurod4 UTSW 10 130270792 nonsense probably null
R6867:Neurod4 UTSW 10 130270714 missense probably damaging 1.00
R7396:Neurod4 UTSW 10 130271022 missense probably damaging 1.00
R7401:Neurod4 UTSW 10 130271058 missense probably damaging 1.00
R7961:Neurod4 UTSW 10 130270487 missense possibly damaging 0.59
R8782:Neurod4 UTSW 10 130271079 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATATGGCCATAAGGAGGG -3'
(R):5'- AAGCTCGCCTTGAAAGATTCAG -3'

Sequencing Primer
(F):5'- CCCTGGAGACTGATAGTTGAAGCTG -3'
(R):5'- CTTGAAAGATTCAGGGCTCGAAG -3'
Posted On2017-10-10