Incidental Mutation 'R0525:Acot12'
ID48869
Institutional Source Beutler Lab
Gene Symbol Acot12
Ensembl Gene ENSMUSG00000021620
Gene Nameacyl-CoA thioesterase 12
SynonymsCach, 1300004O04Rik, 4930449F15Rik
MMRRC Submission 038718-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0525 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location91741512-91786148 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 91760067 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022120]
Predicted Effect probably benign
Transcript: ENSMUST00000022120
SMART Domains Protein: ENSMUSP00000022120
Gene: ENSMUSG00000021620

DomainStartEndE-ValueType
Pfam:4HBT 25 97 4.2e-12 PFAM
Pfam:4HBT 198 275 2.5e-14 PFAM
low complexity region 317 328 N/A INTRINSIC
Pfam:START 350 515 1.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161337
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933440M02Rik T A 7: 125,331,499 noncoding transcript Het
A930002H24Rik A G 17: 63,863,647 W49R unknown Het
Abca13 G A 11: 9,293,371 V1745M probably damaging Het
Abca16 T G 7: 120,465,810 Y563* probably null Het
Alms1 G A 6: 85,587,760 A39T unknown Het
Arid5b T C 10: 68,097,846 D742G possibly damaging Het
Atp1a4 G A 1: 172,239,688 probably benign Het
AU021092 T A 16: 5,217,861 E145V possibly damaging Het
Calr4 A T 4: 109,242,264 probably benign Het
Clip4 T A 17: 71,799,098 probably null Het
Cnpy4 A T 5: 138,192,616 H180L probably benign Het
Cyp2j9 T C 4: 96,579,565 probably null Het
Dgkq A G 5: 108,654,615 S406P probably damaging Het
Dhx8 G A 11: 101,763,928 C1014Y probably damaging Het
Dnah3 T C 7: 119,928,754 Y3824C probably damaging Het
Donson A T 16: 91,686,245 H69Q probably damaging Het
Dppa3 A G 6: 122,629,980 E143G probably damaging Het
Drg1 A G 11: 3,262,545 F96L probably damaging Het
Dvl1 A C 4: 155,855,595 T395P probably damaging Het
Eftud2 A T 11: 102,839,253 V897D probably damaging Het
Enpp6 A G 8: 47,082,443 N341S possibly damaging Het
F11 A G 8: 45,253,049 F100L probably benign Het
Fas T C 19: 34,319,327 Y189H probably damaging Het
Galnt14 G T 17: 73,545,081 S114R probably damaging Het
Gfpt2 A G 11: 49,829,775 I528V probably benign Het
Glt6d1 A G 2: 25,794,268 V242A possibly damaging Het
Grm1 A T 10: 10,719,209 probably benign Het
Gskip G A 12: 105,698,965 A88T probably damaging Het
Gtpbp1 A G 15: 79,713,447 I348V probably benign Het
Hnrnpul1 C A 7: 25,740,883 R316L possibly damaging Het
Il34 T C 8: 110,748,283 E121G probably damaging Het
Lrr1 T C 12: 69,168,911 L19P probably damaging Het
Mat2b A G 11: 40,682,669 probably benign Het
Mettl21e T C 1: 44,206,382 K235E probably damaging Het
Mir124-2hg T A 3: 17,785,529 E126V possibly damaging Het
Myh15 A G 16: 49,132,051 K828R probably benign Het
Myom3 A G 4: 135,764,926 D127G possibly damaging Het
Nek5 C A 8: 22,079,077 probably benign Het
Nudt7 A T 8: 114,151,652 probably null Het
Olfr1056 C T 2: 86,356,275 V36I probably benign Het
Olfr1118 A T 2: 87,309,349 T187S probably benign Het
Olfr1200 G A 2: 88,767,314 Q334* probably null Het
Olfr350 T C 2: 36,850,190 L48P probably damaging Het
Olfr961 T G 9: 39,647,471 C248W probably damaging Het
Phyhd1 A G 2: 30,281,028 H241R probably damaging Het
Pmch T C 10: 88,091,400 probably benign Het
Ror1 A G 4: 100,441,520 S697G probably damaging Het
Rslcan18 A G 13: 67,112,258 V25A probably benign Het
Sema6b T C 17: 56,126,630 H426R probably damaging Het
Serpina3g T C 12: 104,238,339 F9S probably damaging Het
Serpinb12 T A 1: 106,946,702 H52Q probably benign Het
Sh3gl1 T C 17: 56,017,873 K294R probably benign Het
Sidt1 G T 16: 44,259,446 T615K possibly damaging Het
Slc16a4 A C 3: 107,297,939 probably benign Het
Sned1 T A 1: 93,271,974 probably null Het
Sp2 A T 11: 96,956,098 probably benign Het
Steap1 T A 5: 5,742,903 I3F possibly damaging Het
Stxbp5l A T 16: 37,129,797 probably null Het
Tbc1d9 G T 8: 83,268,985 V968F probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Triobp T C 15: 78,973,898 L1233P possibly damaging Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Trpc4ap A G 2: 155,640,478 F531L possibly damaging Het
Ugt1a10 C T 1: 88,218,249 P473L probably damaging Het
Vmn1r86 T C 7: 13,102,161 K213E probably benign Het
Vps8 G A 16: 21,540,109 probably null Het
Wnk1 A T 6: 119,926,564 S2563T probably damaging Het
Yrdc C G 4: 124,851,766 R3G probably damaging Het
Zfp287 A T 11: 62,715,244 V279E probably benign Het
Other mutations in Acot12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Acot12 APN 13 91781211 nonsense probably null
IGL01114:Acot12 APN 13 91757592 splice site probably benign
IGL01376:Acot12 APN 13 91784671 missense probably damaging 0.98
IGL01474:Acot12 APN 13 91772783 missense possibly damaging 0.53
IGL02206:Acot12 APN 13 91759987 missense probably damaging 1.00
IGL02999:Acot12 APN 13 91759981 missense probably damaging 0.97
IGL03237:Acot12 APN 13 91781269 missense probably benign 0.26
R0071:Acot12 UTSW 13 91781174 splice site probably benign
R0092:Acot12 UTSW 13 91741565 missense probably damaging 1.00
R0141:Acot12 UTSW 13 91771828 missense probably benign 0.02
R0331:Acot12 UTSW 13 91760064 critical splice donor site probably null
R0544:Acot12 UTSW 13 91784656 missense probably benign 0.02
R1509:Acot12 UTSW 13 91771875 critical splice donor site probably null
R1616:Acot12 UTSW 13 91772767 missense probably benign 0.02
R1773:Acot12 UTSW 13 91757557 missense probably benign 0.27
R1897:Acot12 UTSW 13 91784397 missense probably benign
R2047:Acot12 UTSW 13 91783003 missense probably damaging 1.00
R2102:Acot12 UTSW 13 91759977 missense probably benign 0.00
R3730:Acot12 UTSW 13 91760026 missense possibly damaging 0.61
R3735:Acot12 UTSW 13 91784346 missense probably benign
R3736:Acot12 UTSW 13 91784346 missense probably benign
R3912:Acot12 UTSW 13 91770089 missense probably benign 0.01
R4156:Acot12 UTSW 13 91784763 missense probably benign 0.00
R4418:Acot12 UTSW 13 91784405 missense possibly damaging 0.46
R4879:Acot12 UTSW 13 91762964 missense probably benign 0.17
R5456:Acot12 UTSW 13 91741640 missense probably damaging 1.00
R5498:Acot12 UTSW 13 91781233 missense probably damaging 1.00
R5601:Acot12 UTSW 13 91782910 missense probably benign 0.10
R5998:Acot12 UTSW 13 91757534 missense possibly damaging 0.49
R6781:Acot12 UTSW 13 91784412 splice site probably null
R7208:Acot12 UTSW 13 91781242 missense probably benign 0.06
R7330:Acot12 UTSW 13 91741532 start codon destroyed probably null 0.89
R7560:Acot12 UTSW 13 91784391 missense probably benign
R7561:Acot12 UTSW 13 91770124 missense probably damaging 0.96
X0050:Acot12 UTSW 13 91771837 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCTTGGAGACGTGTGTGACG -3'
(R):5'- TGGACCATGACTTTCAACTCCTTGC -3'

Sequencing Primer
(F):5'- ACGCAGTTGAATCTATTGTCAGG -3'
(R):5'- GGTATTGCTCTCACAAGATGTTC -3'
Posted On2013-06-12