Incidental Mutation 'R6143:Srsf1'
ID488692
Institutional Source Beutler Lab
Gene Symbol Srsf1
Ensembl Gene ENSMUSG00000018379
Gene Nameserine/arginine-rich splicing factor 1
Synonyms5730507C05Rik, Sfrs1, 6330415C05Rik, 1110054N12Rik
MMRRC Submission 044290-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6143 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location88047373-88053755 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 88049599 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000079866] [ENSMUST00000107920] [ENSMUST00000139129]
Predicted Effect probably benign
Transcript: ENSMUST00000079866
SMART Domains Protein: ENSMUSP00000133517
Gene: ENSMUSG00000018379

DomainStartEndE-ValueType
RRM 17 87 2.85e-19 SMART
low complexity region 89 119 N/A INTRINSIC
RRM 122 188 4.97e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107920
SMART Domains Protein: ENSMUSP00000103553
Gene: ENSMUSG00000018379

DomainStartEndE-ValueType
RRM 17 87 2.85e-19 SMART
low complexity region 89 119 N/A INTRINSIC
RRM 122 188 1.39e-8 SMART
low complexity region 196 246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132983
Predicted Effect probably benign
Transcript: ENSMUST00000134824
SMART Domains Protein: ENSMUSP00000114549
Gene: ENSMUSG00000018379

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
RRM 32 98 1.43e-10 SMART
Predicted Effect unknown
Transcript: ENSMUST00000139129
AA Change: R247H
SMART Domains Protein: ENSMUSP00000120595
Gene: ENSMUSG00000018379
AA Change: R247H

DomainStartEndE-ValueType
RRM 17 87 2.85e-19 SMART
low complexity region 89 119 N/A INTRINSIC
RRM 122 188 1.39e-8 SMART
low complexity region 196 247 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171976
Predicted Effect probably benign
Transcript: ENSMUST00000172186
SMART Domains Protein: ENSMUSP00000128190
Gene: ENSMUSG00000018379

DomainStartEndE-ValueType
SCOP:d1fjeb2 17 43 5e-3 SMART
PDB:2M8D|B 22 47 8e-12 PDB
Blast:RRM 25 47 1e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181900
Meta Mutation Damage Score 0.0595 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null mice display early embryonic lethality. Cardiac specific conditional deletion mutants shows cardiac malfunction and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730061H03Rik A G 14: 55,560,279 probably benign Het
Abcd2 A T 15: 91,190,947 V221E possibly damaging Het
Arhgap39 T A 15: 76,730,406 K853* probably null Het
Art2a-ps T C 7: 101,555,223 D36G possibly damaging Het
Atp13a1 C T 8: 69,805,360 P922S probably benign Het
Brwd1 C T 16: 96,002,956 G2005R probably benign Het
Bzw2 A T 12: 36,120,726 M133K probably benign Het
Cacna1s T G 1: 136,076,758 S346A probably damaging Het
Cebpb C A 2: 167,689,300 D93E probably benign Het
Cep162 C A 9: 87,212,851 probably null Het
Col9a2 A T 4: 121,053,863 Y565F probably damaging Het
Csgalnact1 T A 8: 68,373,550 N372I probably damaging Het
Csmd1 T C 8: 16,088,301 D1579G probably damaging Het
Cyfip2 A C 11: 46,253,965 Y687* probably null Het
Cyp2d34 G A 15: 82,620,776 R28W probably benign Het
Dbndd2 C A 2: 164,488,286 Q13K probably damaging Het
Dnah5 T A 15: 28,233,231 S245R probably benign Het
Dnajb5 A T 4: 42,956,990 T226S probably damaging Het
Dnmt1 T C 9: 20,927,134 E211G probably benign Het
Dnpep G A 1: 75,315,228 H214Y probably damaging Het
Drc3 G A 11: 60,370,580 V186M possibly damaging Het
Dvl3 A G 16: 20,527,039 D413G possibly damaging Het
Dyrk4 C T 6: 126,886,651 probably null Het
Edc4 T A 8: 105,885,874 D181E probably damaging Het
Enthd1 T C 15: 80,509,286 Y247C possibly damaging Het
Gm5622 A T 14: 51,654,915 R50S possibly damaging Het
Gpbp1 G A 13: 111,466,855 T20I probably damaging Het
Hnrnpdl A T 5: 100,036,551 Y276* probably null Het
Hsd3b7 A C 7: 127,801,232 E51A probably damaging Het
Ighv5-16 G T 12: 113,838,618 F87L probably damaging Het
Iqsec1 C T 6: 90,809,684 probably null Het
Irgm2 A T 11: 58,220,609 E387D possibly damaging Het
Klhl23 C A 2: 69,833,696 P463Q possibly damaging Het
Mast4 A T 13: 102,853,883 N43K probably damaging Het
Mme T G 3: 63,300,111 probably null Het
Mrps31 T G 8: 22,411,523 S20A probably benign Het
Myo5c A G 9: 75,249,809 R176G probably damaging Het
Naf1 T C 8: 66,877,695 V291A possibly damaging Het
Nbeal1 A T 1: 60,251,307 H1021L possibly damaging Het
Ncaph2 T C 15: 89,364,003 probably null Het
Neurod4 T G 10: 130,271,000 Y135S probably damaging Het
Nrp2 A T 1: 62,760,815 N396I probably damaging Het
Nvl T G 1: 181,134,995 T137P probably benign Het
Olfr483 A G 7: 108,104,128 D273G probably damaging Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pcdhgc4 T A 18: 37,817,600 S690T possibly damaging Het
Pck1 A T 2: 173,154,012 D101V probably damaging Het
Pdilt T A 7: 119,495,042 N329Y probably damaging Het
Pfkl T A 10: 77,989,613 R648W probably damaging Het
Prtn3 T A 10: 79,880,548 I63N probably damaging Het
Psg22 C T 7: 18,722,798 A163V probably benign Het
Pten A G 19: 32,800,085 T160A possibly damaging Het
Retreg2 A G 1: 75,146,886 D449G probably damaging Het
Scn9a T C 2: 66,487,524 Y1531C probably benign Het
Sgk2 T A 2: 162,999,254 C195S probably damaging Het
Slc19a3 C T 1: 83,026,339 V14I probably benign Het
Snai2 A T 16: 14,708,243 R253* probably null Het
Speg G A 1: 75,414,387 V1512I probably damaging Het
Tctn3 G T 19: 40,609,227 T190N probably benign Het
Tmprss11f T A 5: 86,539,699 I117L probably benign Het
Ttn G A 2: 76,852,069 R959* probably null Het
Vmn2r118 G T 17: 55,592,871 L678I possibly damaging Het
Vps13b T C 15: 35,668,738 S1594P probably damaging Het
Vps13d G T 4: 145,148,565 H1791N possibly damaging Het
Other mutations in Srsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Srsf1 APN 11 88049181 missense possibly damaging 0.88
IGL02949:Srsf1 APN 11 88049526 intron probably benign
IGL03100:Srsf1 APN 11 88049128 missense probably damaging 1.00
R4898:Srsf1 UTSW 11 88049962 splice site probably null
R5261:Srsf1 UTSW 11 88047858 missense possibly damaging 0.96
R5328:Srsf1 UTSW 11 88049993 utr 3 prime probably benign
R5593:Srsf1 UTSW 11 88047879 missense possibly damaging 0.47
R5849:Srsf1 UTSW 11 88047858 missense possibly damaging 0.56
R7151:Srsf1 UTSW 11 88049258 nonsense probably null
R8099:Srsf1 UTSW 11 88049256 missense probably benign
R8294:Srsf1 UTSW 11 88048641 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTTAAAGTTGATGGGCCCAG -3'
(R):5'- ATCACAGTCTGAAGAGCATGG -3'

Sequencing Primer
(F):5'- TGGGCCCAGAAGTCCAAGTTATG -3'
(R):5'- CAGTCTGAAGAGCATGGAAATTAAC -3'
Posted On2017-10-10