Incidental Mutation 'R0525:Triobp'
ID 48870
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene Name TRIO and F-actin binding protein
Synonyms EST478828, Mus EST 478828, Tara
MMRRC Submission 038718-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0525 (G1)
Quality Score 180
Status Validated
Chromosome 15
Chromosomal Location 78831924-78890069 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78858098 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1233 (L1233P)
Ref Sequence ENSEMBL: ENSMUSP00000105312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000229270]
AlphaFold Q99KW3
Predicted Effect possibly damaging
Transcript: ENSMUST00000109689
AA Change: L1233P

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: L1233P

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109690
AA Change: L1233P

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: L1233P

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229270
Meta Mutation Damage Score 0.3272 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933440M02Rik T A 7: 124,930,671 (GRCm39) noncoding transcript Het
A930002H24Rik A G 17: 64,170,642 (GRCm39) W49R unknown Het
Abca13 G A 11: 9,243,371 (GRCm39) V1745M probably damaging Het
Abca16 T G 7: 120,065,033 (GRCm39) Y563* probably null Het
Acot12 C T 13: 91,908,186 (GRCm39) probably benign Het
Alms1 G A 6: 85,564,742 (GRCm39) A39T unknown Het
Arid5b T C 10: 67,933,676 (GRCm39) D742G possibly damaging Het
Atp1a4 G A 1: 172,067,255 (GRCm39) probably benign Het
AU021092 T A 16: 5,035,725 (GRCm39) E145V possibly damaging Het
Calr4 A T 4: 109,099,461 (GRCm39) probably benign Het
Clip4 T A 17: 72,106,093 (GRCm39) probably null Het
Cnpy4 A T 5: 138,190,878 (GRCm39) H180L probably benign Het
Cyp2j9 T C 4: 96,467,802 (GRCm39) probably null Het
Dgkq A G 5: 108,802,481 (GRCm39) S406P probably damaging Het
Dhx8 G A 11: 101,654,754 (GRCm39) C1014Y probably damaging Het
Dnah3 T C 7: 119,527,977 (GRCm39) Y3824C probably damaging Het
Donson A T 16: 91,483,133 (GRCm39) H69Q probably damaging Het
Dppa3 A G 6: 122,606,939 (GRCm39) E143G probably damaging Het
Drg1 A G 11: 3,212,545 (GRCm39) F96L probably damaging Het
Dvl1 A C 4: 155,940,052 (GRCm39) T395P probably damaging Het
Eftud2 A T 11: 102,730,079 (GRCm39) V897D probably damaging Het
Enpp6 A G 8: 47,535,478 (GRCm39) N341S possibly damaging Het
F11 A G 8: 45,706,086 (GRCm39) F100L probably benign Het
Fas T C 19: 34,296,727 (GRCm39) Y189H probably damaging Het
Galnt14 G T 17: 73,852,076 (GRCm39) S114R probably damaging Het
Gfpt2 A G 11: 49,720,602 (GRCm39) I528V probably benign Het
Glt6d1 A G 2: 25,684,280 (GRCm39) V242A possibly damaging Het
Grm1 A T 10: 10,594,953 (GRCm39) probably benign Het
Gskip G A 12: 105,665,224 (GRCm39) A88T probably damaging Het
Gtpbp1 A G 15: 79,597,648 (GRCm39) I348V probably benign Het
Hnrnpul1 C A 7: 25,440,308 (GRCm39) R316L possibly damaging Het
Il34 T C 8: 111,474,915 (GRCm39) E121G probably damaging Het
Lrr1 T C 12: 69,215,685 (GRCm39) L19P probably damaging Het
Mat2b A G 11: 40,573,496 (GRCm39) probably benign Het
Mettl21e T C 1: 44,245,542 (GRCm39) K235E probably damaging Het
Mir124-2hg T A 3: 17,839,693 (GRCm39) E126V possibly damaging Het
Myh15 A G 16: 48,952,414 (GRCm39) K828R probably benign Het
Myom3 A G 4: 135,492,237 (GRCm39) D127G possibly damaging Het
Nek5 C A 8: 22,569,093 (GRCm39) probably benign Het
Nudt7 A T 8: 114,878,392 (GRCm39) probably null Het
Or10ag56 A T 2: 87,139,693 (GRCm39) T187S probably benign Het
Or10d4c T G 9: 39,558,767 (GRCm39) C248W probably damaging Het
Or1j4 T C 2: 36,740,202 (GRCm39) L48P probably damaging Het
Or4a67 G A 2: 88,597,658 (GRCm39) Q334* probably null Het
Or8k23 C T 2: 86,186,619 (GRCm39) V36I probably benign Het
Phyhd1 A G 2: 30,171,040 (GRCm39) H241R probably damaging Het
Pmch T C 10: 87,927,262 (GRCm39) probably benign Het
Ror1 A G 4: 100,298,717 (GRCm39) S697G probably damaging Het
Rslcan18 A G 13: 67,260,322 (GRCm39) V25A probably benign Het
Sema6b T C 17: 56,433,630 (GRCm39) H426R probably damaging Het
Serpina3g T C 12: 104,204,598 (GRCm39) F9S probably damaging Het
Serpinb12 T A 1: 106,874,432 (GRCm39) H52Q probably benign Het
Sh3gl1 T C 17: 56,324,873 (GRCm39) K294R probably benign Het
Sidt1 G T 16: 44,079,809 (GRCm39) T615K possibly damaging Het
Slc16a4 A C 3: 107,205,255 (GRCm39) probably benign Het
Sned1 T A 1: 93,199,696 (GRCm39) probably null Het
Sp2 A T 11: 96,846,924 (GRCm39) probably benign Het
Steap1 T A 5: 5,792,903 (GRCm39) I3F possibly damaging Het
Stxbp5l A T 16: 36,950,159 (GRCm39) probably null Het
Tbc1d9 G T 8: 83,995,614 (GRCm39) V968F probably benign Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Trp53bp1 C A 2: 121,082,349 (GRCm39) A317S probably null Het
Trpc4ap A G 2: 155,482,398 (GRCm39) F531L possibly damaging Het
Ugt1a10 C T 1: 88,145,971 (GRCm39) P473L probably damaging Het
Vmn1r86 T C 7: 12,836,088 (GRCm39) K213E probably benign Het
Vps8 G A 16: 21,358,859 (GRCm39) probably null Het
Wnk1 A T 6: 119,903,525 (GRCm39) S2563T probably damaging Het
Yrdc C G 4: 124,745,559 (GRCm39) R3G probably damaging Het
Zfp287 A T 11: 62,606,070 (GRCm39) V279E probably benign Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78,877,568 (GRCm39) missense probably damaging 1.00
IGL01904:Triobp APN 15 78,851,564 (GRCm39) missense possibly damaging 0.80
IGL01957:Triobp APN 15 78,856,847 (GRCm39) critical splice donor site probably null
IGL02085:Triobp APN 15 78,858,497 (GRCm39) splice site probably benign
IGL02260:Triobp APN 15 78,850,562 (GRCm39) missense probably benign 0.00
IGL02498:Triobp APN 15 78,845,243 (GRCm39) missense probably benign 0.01
IGL02551:Triobp APN 15 78,857,689 (GRCm39) missense probably benign
IGL02740:Triobp APN 15 78,850,889 (GRCm39) missense probably benign 0.21
IGL02810:Triobp APN 15 78,886,403 (GRCm39) missense possibly damaging 0.95
IGL03063:Triobp APN 15 78,875,084 (GRCm39) missense probably damaging 1.00
FR4304:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
FR4340:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4342:Triobp UTSW 15 78,877,592 (GRCm39) unclassified probably benign
FR4449:Triobp UTSW 15 78,877,589 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
R0276:Triobp UTSW 15 78,857,876 (GRCm39) missense probably benign 0.09
R0309:Triobp UTSW 15 78,860,740 (GRCm39) missense probably damaging 1.00
R0433:Triobp UTSW 15 78,852,401 (GRCm39) missense possibly damaging 0.69
R0464:Triobp UTSW 15 78,851,186 (GRCm39) missense possibly damaging 0.71
R0665:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0689:Triobp UTSW 15 78,844,188 (GRCm39) nonsense probably null
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1151:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1152:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1510:Triobp UTSW 15 78,887,967 (GRCm39) missense probably damaging 1.00
R1519:Triobp UTSW 15 78,857,938 (GRCm39) missense probably benign 0.00
R1642:Triobp UTSW 15 78,886,348 (GRCm39) missense probably damaging 1.00
R1732:Triobp UTSW 15 78,851,428 (GRCm39) missense possibly damaging 0.69
R1755:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1975:Triobp UTSW 15 78,850,908 (GRCm39) missense probably benign
R2051:Triobp UTSW 15 78,888,740 (GRCm39) missense probably damaging 1.00
R2073:Triobp UTSW 15 78,858,095 (GRCm39) missense probably damaging 0.99
R2260:Triobp UTSW 15 78,875,640 (GRCm39) critical splice donor site probably null
R2351:Triobp UTSW 15 78,888,780 (GRCm39) missense probably benign 0.09
R2902:Triobp UTSW 15 78,857,618 (GRCm39) missense possibly damaging 0.90
R3801:Triobp UTSW 15 78,857,900 (GRCm39) missense probably benign 0.04
R3959:Triobp UTSW 15 78,886,589 (GRCm39) nonsense probably null
R4003:Triobp UTSW 15 78,844,177 (GRCm39) unclassified probably benign
R4084:Triobp UTSW 15 78,857,871 (GRCm39) missense probably benign 0.19
R4482:Triobp UTSW 15 78,850,763 (GRCm39) missense possibly damaging 0.87
R4592:Triobp UTSW 15 78,851,295 (GRCm39) missense probably benign
R4662:Triobp UTSW 15 78,877,469 (GRCm39) missense probably damaging 1.00
R4732:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4733:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4789:Triobp UTSW 15 78,875,228 (GRCm39) missense probably damaging 1.00
R4968:Triobp UTSW 15 78,850,816 (GRCm39) missense probably benign 0.03
R4990:Triobp UTSW 15 78,851,205 (GRCm39) missense probably benign 0.00
R5129:Triobp UTSW 15 78,845,296 (GRCm39) missense probably benign 0.15
R5181:Triobp UTSW 15 78,851,954 (GRCm39) missense probably benign 0.00
R5279:Triobp UTSW 15 78,878,591 (GRCm39) missense possibly damaging 0.66
R5584:Triobp UTSW 15 78,852,332 (GRCm39) missense possibly damaging 0.89
R5601:Triobp UTSW 15 78,857,833 (GRCm39) missense probably damaging 1.00
R5810:Triobp UTSW 15 78,852,467 (GRCm39) missense probably benign 0.07
R5969:Triobp UTSW 15 78,851,740 (GRCm39) missense probably benign 0.05
R6722:Triobp UTSW 15 78,885,765 (GRCm39) missense probably damaging 1.00
R6739:Triobp UTSW 15 78,850,566 (GRCm39) missense possibly damaging 0.77
R6810:Triobp UTSW 15 78,850,815 (GRCm39) missense possibly damaging 0.47
R7011:Triobp UTSW 15 78,862,923 (GRCm39) missense probably damaging 0.98
R7015:Triobp UTSW 15 78,878,260 (GRCm39) missense probably damaging 0.99
R7200:Triobp UTSW 15 78,851,042 (GRCm39) small deletion probably benign
R7294:Triobp UTSW 15 78,858,176 (GRCm39) missense probably damaging 0.99
R7688:Triobp UTSW 15 78,845,311 (GRCm39) splice site probably null
R7805:Triobp UTSW 15 78,858,204 (GRCm39) missense probably benign 0.37
R7972:Triobp UTSW 15 78,852,186 (GRCm39) missense probably damaging 1.00
R7977:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7987:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7999:Triobp UTSW 15 78,844,144 (GRCm39) missense probably damaging 0.99
R8344:Triobp UTSW 15 78,842,475 (GRCm39) missense possibly damaging 0.67
R8348:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8446:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8448:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8469:Triobp UTSW 15 78,851,219 (GRCm39) missense probably benign 0.00
R8491:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8492:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8493:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R9424:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9495:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9514:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9530:Triobp UTSW 15 78,886,321 (GRCm39) missense probably damaging 1.00
R9550:Triobp UTSW 15 78,858,077 (GRCm39) missense probably damaging 1.00
R9576:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9646:Triobp UTSW 15 78,887,934 (GRCm39) missense probably damaging 1.00
RF001:Triobp UTSW 15 78,851,227 (GRCm39) small insertion probably benign
RF005:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF007:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
RF022:Triobp UTSW 15 78,858,482 (GRCm39) missense probably benign 0.05
RF028:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF032:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF035:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF040:Triobp UTSW 15 78,851,263 (GRCm39) small insertion probably benign
RF049:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF051:Triobp UTSW 15 78,851,234 (GRCm39) small insertion probably benign
RF058:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
X0026:Triobp UTSW 15 78,844,223 (GRCm39) missense possibly damaging 0.94
Z1177:Triobp UTSW 15 78,886,381 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCCCAGTAATGGGATACAGG -3'
(R):5'- AGATACAGGGCAGACTTACCTCCAG -3'

Sequencing Primer
(F):5'- TAGACTTCAGGAGCTGTCCAG -3'
(R):5'- CTAGGTGATCTATCTGCTCCAGAG -3'
Posted On 2013-06-12