Incidental Mutation 'R0525:Triobp'
ID 48870
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene Name TRIO and F-actin binding protein
Synonyms EST478828, Mus EST 478828, Tara
MMRRC Submission 038718-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0525 (G1)
Quality Score 180
Status Validated
Chromosome 15
Chromosomal Location 78947724-79005869 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78973898 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1233 (L1233P)
Ref Sequence ENSEMBL: ENSMUSP00000105312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000229270]
AlphaFold Q99KW3
Predicted Effect possibly damaging
Transcript: ENSMUST00000109689
AA Change: L1233P

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: L1233P

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109690
AA Change: L1233P

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: L1233P

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229270
Meta Mutation Damage Score 0.3272 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933440M02Rik T A 7: 125,331,499 noncoding transcript Het
A930002H24Rik A G 17: 63,863,647 W49R unknown Het
Abca13 G A 11: 9,293,371 V1745M probably damaging Het
Abca16 T G 7: 120,465,810 Y563* probably null Het
Acot12 C T 13: 91,760,067 probably benign Het
Alms1 G A 6: 85,587,760 A39T unknown Het
Arid5b T C 10: 68,097,846 D742G possibly damaging Het
Atp1a4 G A 1: 172,239,688 probably benign Het
AU021092 T A 16: 5,217,861 E145V possibly damaging Het
Calr4 A T 4: 109,242,264 probably benign Het
Clip4 T A 17: 71,799,098 probably null Het
Cnpy4 A T 5: 138,192,616 H180L probably benign Het
Cyp2j9 T C 4: 96,579,565 probably null Het
Dgkq A G 5: 108,654,615 S406P probably damaging Het
Dhx8 G A 11: 101,763,928 C1014Y probably damaging Het
Dnah3 T C 7: 119,928,754 Y3824C probably damaging Het
Donson A T 16: 91,686,245 H69Q probably damaging Het
Dppa3 A G 6: 122,629,980 E143G probably damaging Het
Drg1 A G 11: 3,262,545 F96L probably damaging Het
Dvl1 A C 4: 155,855,595 T395P probably damaging Het
Eftud2 A T 11: 102,839,253 V897D probably damaging Het
Enpp6 A G 8: 47,082,443 N341S possibly damaging Het
F11 A G 8: 45,253,049 F100L probably benign Het
Fas T C 19: 34,319,327 Y189H probably damaging Het
Galnt14 G T 17: 73,545,081 S114R probably damaging Het
Gfpt2 A G 11: 49,829,775 I528V probably benign Het
Glt6d1 A G 2: 25,794,268 V242A possibly damaging Het
Grm1 A T 10: 10,719,209 probably benign Het
Gskip G A 12: 105,698,965 A88T probably damaging Het
Gtpbp1 A G 15: 79,713,447 I348V probably benign Het
Hnrnpul1 C A 7: 25,740,883 R316L possibly damaging Het
Il34 T C 8: 110,748,283 E121G probably damaging Het
Lrr1 T C 12: 69,168,911 L19P probably damaging Het
Mat2b A G 11: 40,682,669 probably benign Het
Mettl21e T C 1: 44,206,382 K235E probably damaging Het
Mir124-2hg T A 3: 17,785,529 E126V possibly damaging Het
Myh15 A G 16: 49,132,051 K828R probably benign Het
Myom3 A G 4: 135,764,926 D127G possibly damaging Het
Nek5 C A 8: 22,079,077 probably benign Het
Nudt7 A T 8: 114,151,652 probably null Het
Olfr1056 C T 2: 86,356,275 V36I probably benign Het
Olfr1118 A T 2: 87,309,349 T187S probably benign Het
Olfr1200 G A 2: 88,767,314 Q334* probably null Het
Olfr350 T C 2: 36,850,190 L48P probably damaging Het
Olfr961 T G 9: 39,647,471 C248W probably damaging Het
Phyhd1 A G 2: 30,281,028 H241R probably damaging Het
Pmch T C 10: 88,091,400 probably benign Het
Ror1 A G 4: 100,441,520 S697G probably damaging Het
Rslcan18 A G 13: 67,112,258 V25A probably benign Het
Sema6b T C 17: 56,126,630 H426R probably damaging Het
Serpina3g T C 12: 104,238,339 F9S probably damaging Het
Serpinb12 T A 1: 106,946,702 H52Q probably benign Het
Sh3gl1 T C 17: 56,017,873 K294R probably benign Het
Sidt1 G T 16: 44,259,446 T615K possibly damaging Het
Slc16a4 A C 3: 107,297,939 probably benign Het
Sned1 T A 1: 93,271,974 probably null Het
Sp2 A T 11: 96,956,098 probably benign Het
Steap1 T A 5: 5,742,903 I3F possibly damaging Het
Stxbp5l A T 16: 37,129,797 probably null Het
Tbc1d9 G T 8: 83,268,985 V968F probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Trpc4ap A G 2: 155,640,478 F531L possibly damaging Het
Ugt1a10 C T 1: 88,218,249 P473L probably damaging Het
Vmn1r86 T C 7: 13,102,161 K213E probably benign Het
Vps8 G A 16: 21,540,109 probably null Het
Wnk1 A T 6: 119,926,564 S2563T probably damaging Het
Yrdc C G 4: 124,851,766 R3G probably damaging Het
Zfp287 A T 11: 62,715,244 V279E probably benign Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78993368 missense probably damaging 1.00
IGL01904:Triobp APN 15 78967364 missense possibly damaging 0.80
IGL01957:Triobp APN 15 78972647 critical splice donor site probably null
IGL02085:Triobp APN 15 78974297 splice site probably benign
IGL02260:Triobp APN 15 78966362 missense probably benign 0.00
IGL02498:Triobp APN 15 78961043 missense probably benign 0.01
IGL02551:Triobp APN 15 78973489 missense probably benign
IGL02740:Triobp APN 15 78966689 missense probably benign 0.21
IGL02810:Triobp APN 15 79002203 missense possibly damaging 0.95
IGL03063:Triobp APN 15 78990884 missense probably damaging 1.00
FR4304:Triobp UTSW 15 78993387 unclassified probably benign
FR4340:Triobp UTSW 15 78993390 unclassified probably benign
FR4342:Triobp UTSW 15 78993392 unclassified probably benign
FR4449:Triobp UTSW 15 78993389 unclassified probably benign
FR4548:Triobp UTSW 15 78993387 unclassified probably benign
FR4548:Triobp UTSW 15 78993390 unclassified probably benign
R0276:Triobp UTSW 15 78973676 missense probably benign 0.09
R0309:Triobp UTSW 15 78976540 missense probably damaging 1.00
R0433:Triobp UTSW 15 78968201 missense possibly damaging 0.69
R0464:Triobp UTSW 15 78966986 missense possibly damaging 0.71
R0665:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0689:Triobp UTSW 15 78959988 nonsense probably null
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1151:Triobp UTSW 15 78966479 missense probably benign 0.00
R1152:Triobp UTSW 15 78966479 missense probably benign 0.00
R1510:Triobp UTSW 15 79003767 missense probably damaging 1.00
R1519:Triobp UTSW 15 78973738 missense probably benign 0.00
R1642:Triobp UTSW 15 79002148 missense probably damaging 1.00
R1732:Triobp UTSW 15 78967228 missense possibly damaging 0.69
R1755:Triobp UTSW 15 78966479 missense probably benign 0.00
R1975:Triobp UTSW 15 78966708 missense probably benign
R2051:Triobp UTSW 15 79004540 missense probably damaging 1.00
R2073:Triobp UTSW 15 78973895 missense probably damaging 0.99
R2260:Triobp UTSW 15 78991440 critical splice donor site probably null
R2351:Triobp UTSW 15 79004580 missense probably benign 0.09
R2902:Triobp UTSW 15 78973418 missense possibly damaging 0.90
R3801:Triobp UTSW 15 78973700 missense probably benign 0.04
R3959:Triobp UTSW 15 79002389 nonsense probably null
R4003:Triobp UTSW 15 78959977 unclassified probably benign
R4084:Triobp UTSW 15 78973671 missense probably benign 0.19
R4482:Triobp UTSW 15 78966563 missense possibly damaging 0.87
R4592:Triobp UTSW 15 78967095 missense probably benign
R4662:Triobp UTSW 15 78993269 missense probably damaging 1.00
R4732:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4733:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4789:Triobp UTSW 15 78991028 missense probably damaging 1.00
R4968:Triobp UTSW 15 78966616 missense probably benign 0.03
R4990:Triobp UTSW 15 78967005 missense probably benign 0.00
R5129:Triobp UTSW 15 78961096 missense probably benign 0.15
R5181:Triobp UTSW 15 78967754 missense probably benign 0.00
R5279:Triobp UTSW 15 78994391 missense possibly damaging 0.66
R5584:Triobp UTSW 15 78968132 missense possibly damaging 0.89
R5601:Triobp UTSW 15 78973633 missense probably damaging 1.00
R5810:Triobp UTSW 15 78968267 missense probably benign 0.07
R5969:Triobp UTSW 15 78967540 missense probably benign 0.05
R6722:Triobp UTSW 15 79001565 missense probably damaging 1.00
R6739:Triobp UTSW 15 78966366 missense possibly damaging 0.77
R6810:Triobp UTSW 15 78966615 missense possibly damaging 0.47
R7011:Triobp UTSW 15 78978723 missense probably damaging 0.98
R7015:Triobp UTSW 15 78994060 missense probably damaging 0.99
R7200:Triobp UTSW 15 78966842 small deletion probably benign
R7294:Triobp UTSW 15 78973976 missense probably damaging 0.99
R7688:Triobp UTSW 15 78961111 splice site probably null
R7805:Triobp UTSW 15 78974004 missense probably benign 0.37
R7972:Triobp UTSW 15 78967986 missense probably damaging 1.00
R7977:Triobp UTSW 15 79001544 missense probably damaging 1.00
R7987:Triobp UTSW 15 79001544 missense probably damaging 1.00
R7999:Triobp UTSW 15 78959944 missense probably damaging 0.99
R8344:Triobp UTSW 15 78958275 missense possibly damaging 0.67
R8348:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8446:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8448:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8469:Triobp UTSW 15 78967019 missense probably benign 0.00
R8491:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8492:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8493:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R9424:Triobp UTSW 15 78960066 missense probably damaging 1.00
RF001:Triobp UTSW 15 78967027 small insertion probably benign
RF005:Triobp UTSW 15 78967061 small insertion probably benign
RF007:Triobp UTSW 15 78967044 small insertion probably benign
RF022:Triobp UTSW 15 78974282 missense probably benign 0.05
RF028:Triobp UTSW 15 78967039 small insertion probably benign
RF032:Triobp UTSW 15 78967036 small insertion probably benign
RF035:Triobp UTSW 15 78967039 small insertion probably benign
RF039:Triobp UTSW 15 78967036 small insertion probably benign
RF039:Triobp UTSW 15 78967039 small insertion probably benign
RF040:Triobp UTSW 15 78967063 small insertion probably benign
RF049:Triobp UTSW 15 78967061 small insertion probably benign
RF051:Triobp UTSW 15 78967034 small insertion probably benign
RF058:Triobp UTSW 15 78967044 small insertion probably benign
X0026:Triobp UTSW 15 78960023 missense possibly damaging 0.94
Z1177:Triobp UTSW 15 79002181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCCCAGTAATGGGATACAGG -3'
(R):5'- AGATACAGGGCAGACTTACCTCCAG -3'

Sequencing Primer
(F):5'- TAGACTTCAGGAGCTGTCCAG -3'
(R):5'- CTAGGTGATCTATCTGCTCCAGAG -3'
Posted On 2013-06-12