Incidental Mutation 'R6143:Abcd2'
ID488706
Institutional Source Beutler Lab
Gene Symbol Abcd2
Ensembl Gene ENSMUSG00000055782
Gene NameATP-binding cassette, sub-family D (ALD), member 2
SynonymsABC39, adrenoleukodystrophy related, ALDL1, ALDR
MMRRC Submission 044290-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R6143 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location91145871-91191799 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91190947 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 221 (V221E)
Ref Sequence ENSEMBL: ENSMUSP00000068940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069511]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069511
AA Change: V221E

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068940
Gene: ENSMUSG00000055782
AA Change: V221E

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
Pfam:ABC_membrane_2 78 365 1.9e-110 PFAM
AAA 504 690 2.79e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230461
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. The function of this peroxisomal membrane protein is unknown; however this protein is speculated to function as a dimerization partner of Abcd1 and/or other peroxisomal ABC transporters. Mutations in the human gene have been observed in patients with adrenoleukodystrophy, a severe demyelinating disease. This gene has been identified as a candidate for a modifier gene, accounting for the extreme variation among adrenoleukodystrophy phenotypes. This gene is also a candidate for a complement group of Zellweger syndrome, a genetically heterogeneous disorder of peroxisomal biogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene exhibit a late-onset cerebellar and sensory ataxia, loss of Purkinje cells, dorsal root ganglia cell degeneration, axonal degeneration in the spinal cord, and an accumulation of very long chain fatty acids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730061H03Rik A G 14: 55,560,279 probably benign Het
Arhgap39 T A 15: 76,730,406 K853* probably null Het
Art2a-ps T C 7: 101,555,223 D36G possibly damaging Het
Atp13a1 C T 8: 69,805,360 P922S probably benign Het
Brwd1 C T 16: 96,002,956 G2005R probably benign Het
Bzw2 A T 12: 36,120,726 M133K probably benign Het
Cacna1s T G 1: 136,076,758 S346A probably damaging Het
Cebpb C A 2: 167,689,300 D93E probably benign Het
Cep162 C A 9: 87,212,851 probably null Het
Col9a2 A T 4: 121,053,863 Y565F probably damaging Het
Csgalnact1 T A 8: 68,373,550 N372I probably damaging Het
Csmd1 T C 8: 16,088,301 D1579G probably damaging Het
Cyfip2 A C 11: 46,253,965 Y687* probably null Het
Cyp2d34 G A 15: 82,620,776 R28W probably benign Het
Dbndd2 C A 2: 164,488,286 Q13K probably damaging Het
Dnah5 T A 15: 28,233,231 S245R probably benign Het
Dnajb5 A T 4: 42,956,990 T226S probably damaging Het
Dnmt1 T C 9: 20,927,134 E211G probably benign Het
Dnpep G A 1: 75,315,228 H214Y probably damaging Het
Drc3 G A 11: 60,370,580 V186M possibly damaging Het
Dvl3 A G 16: 20,527,039 D413G possibly damaging Het
Dyrk4 C T 6: 126,886,651 probably null Het
Edc4 T A 8: 105,885,874 D181E probably damaging Het
Enthd1 T C 15: 80,509,286 Y247C possibly damaging Het
Gm5622 A T 14: 51,654,915 R50S possibly damaging Het
Gpbp1 G A 13: 111,466,855 T20I probably damaging Het
Hnrnpdl A T 5: 100,036,551 Y276* probably null Het
Hsd3b7 A C 7: 127,801,232 E51A probably damaging Het
Ighv5-16 G T 12: 113,838,618 F87L probably damaging Het
Iqsec1 C T 6: 90,809,684 probably null Het
Irgm2 A T 11: 58,220,609 E387D possibly damaging Het
Klhl23 C A 2: 69,833,696 P463Q possibly damaging Het
Mast4 A T 13: 102,853,883 N43K probably damaging Het
Mme T G 3: 63,300,111 probably null Het
Mrps31 T G 8: 22,411,523 S20A probably benign Het
Myo5c A G 9: 75,249,809 R176G probably damaging Het
Naf1 T C 8: 66,877,695 V291A possibly damaging Het
Nbeal1 A T 1: 60,251,307 H1021L possibly damaging Het
Ncaph2 T C 15: 89,364,003 probably null Het
Neurod4 T G 10: 130,271,000 Y135S probably damaging Het
Nrp2 A T 1: 62,760,815 N396I probably damaging Het
Nvl T G 1: 181,134,995 T137P probably benign Het
Olfr483 A G 7: 108,104,128 D273G probably damaging Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pcdhgc4 T A 18: 37,817,600 S690T possibly damaging Het
Pck1 A T 2: 173,154,012 D101V probably damaging Het
Pdilt T A 7: 119,495,042 N329Y probably damaging Het
Pfkl T A 10: 77,989,613 R648W probably damaging Het
Prtn3 T A 10: 79,880,548 I63N probably damaging Het
Psg22 C T 7: 18,722,798 A163V probably benign Het
Pten A G 19: 32,800,085 T160A possibly damaging Het
Retreg2 A G 1: 75,146,886 D449G probably damaging Het
Scn9a T C 2: 66,487,524 Y1531C probably benign Het
Sgk2 T A 2: 162,999,254 C195S probably damaging Het
Slc19a3 C T 1: 83,026,339 V14I probably benign Het
Snai2 A T 16: 14,708,243 R253* probably null Het
Speg G A 1: 75,414,387 V1512I probably damaging Het
Srsf1 G A 11: 88,049,599 probably benign Het
Tctn3 G T 19: 40,609,227 T190N probably benign Het
Tmprss11f T A 5: 86,539,699 I117L probably benign Het
Ttn G A 2: 76,852,069 R959* probably null Het
Vmn2r118 G T 17: 55,592,871 L678I possibly damaging Het
Vps13b T C 15: 35,668,738 S1594P probably damaging Het
Vps13d G T 4: 145,148,565 H1791N possibly damaging Het
Other mutations in Abcd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Abcd2 APN 15 91149213 splice site probably benign
IGL01515:Abcd2 APN 15 91163086 missense probably damaging 1.00
IGL01733:Abcd2 APN 15 91191614 utr 5 prime probably benign
IGL02084:Abcd2 APN 15 91178327 critical splice acceptor site probably null
IGL02408:Abcd2 APN 15 91178241 missense possibly damaging 0.95
IGL02568:Abcd2 APN 15 91148981 utr 3 prime probably benign
IGL02942:Abcd2 APN 15 91149175 missense probably damaging 0.99
IGL03281:Abcd2 APN 15 91151673 missense probably damaging 1.00
R0463:Abcd2 UTSW 15 91159124 missense probably benign 0.01
R1226:Abcd2 UTSW 15 91191043 missense probably benign
R1510:Abcd2 UTSW 15 91188978 missense probably damaging 1.00
R1581:Abcd2 UTSW 15 91179144 missense probably benign
R1802:Abcd2 UTSW 15 91163102 missense probably benign
R1918:Abcd2 UTSW 15 91191481 missense probably benign
R2184:Abcd2 UTSW 15 91191439 missense probably benign
R3820:Abcd2 UTSW 15 91174705 missense probably damaging 0.99
R3821:Abcd2 UTSW 15 91174705 missense probably damaging 0.99
R4486:Abcd2 UTSW 15 91178283 missense probably damaging 0.99
R4487:Abcd2 UTSW 15 91178283 missense probably damaging 0.99
R4489:Abcd2 UTSW 15 91178283 missense probably damaging 0.99
R4706:Abcd2 UTSW 15 91159182 missense probably benign 0.03
R4707:Abcd2 UTSW 15 91159182 missense probably benign 0.03
R4727:Abcd2 UTSW 15 91178286 missense probably benign 0.33
R4872:Abcd2 UTSW 15 91191311 missense probably benign
R4971:Abcd2 UTSW 15 91163110 missense probably benign 0.06
R5492:Abcd2 UTSW 15 91188973 missense probably benign
R6049:Abcd2 UTSW 15 91178236 missense probably benign 0.00
R6177:Abcd2 UTSW 15 91190693 missense probably damaging 0.99
R6566:Abcd2 UTSW 15 91191118 missense probably damaging 1.00
R7108:Abcd2 UTSW 15 91191274 missense probably benign 0.43
R7208:Abcd2 UTSW 15 91190682 nonsense probably null
R7212:Abcd2 UTSW 15 91159123 missense possibly damaging 0.84
R7497:Abcd2 UTSW 15 91191176 missense probably benign
R7505:Abcd2 UTSW 15 91149057 missense possibly damaging 0.60
R7732:Abcd2 UTSW 15 91191248 missense possibly damaging 0.64
R8119:Abcd2 UTSW 15 91148994 missense probably benign 0.00
R8203:Abcd2 UTSW 15 91191166 missense probably benign
R8444:Abcd2 UTSW 15 91174636 missense probably benign 0.00
R8859:Abcd2 UTSW 15 91188946 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATTCGGGAGTGGACATACC -3'
(R):5'- ACCTGGAATGCAAACTGGC -3'

Sequencing Primer
(F):5'- CAGGTAGCCTTTCCTGTGG -3'
(R):5'- GCATTGGCCTTTAGAACTCG -3'
Posted On2017-10-10