Incidental Mutation 'R6144:Dennd1b'
ID488715
Institutional Source Beutler Lab
Gene Symbol Dennd1b
Ensembl Gene ENSMUSG00000056268
Gene NameDENN/MADD domain containing 1B
Synonyms4632404N19Rik, 6820401H01Rik, 4930467M19Rik, F730008N07Rik
MMRRC Submission 044291-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6144 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location138963435-139178960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139081255 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 232 (H232R)
Ref Sequence ENSEMBL: ENSMUSP00000143783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094505] [ENSMUST00000168527] [ENSMUST00000198759] [ENSMUST00000200429]
Predicted Effect probably damaging
Transcript: ENSMUST00000094505
AA Change: H157R

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092082
Gene: ENSMUSG00000056268
AA Change: H157R

DomainStartEndE-ValueType
DENN 15 196 1.14e-74 SMART
dDENN 227 293 1.07e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168527
AA Change: H232R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127580
Gene: ENSMUSG00000056268
AA Change: H232R

DomainStartEndE-ValueType
uDENN 9 89 7.86e-28 SMART
DENN 90 271 1.14e-74 SMART
dDENN 302 368 1.07e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198418
Predicted Effect probably benign
Transcript: ENSMUST00000198759
Predicted Effect probably damaging
Transcript: ENSMUST00000200429
AA Change: H232R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143783
Gene: ENSMUSG00000056268
AA Change: H232R

DomainStartEndE-ValueType
uDENN 9 89 3.2e-31 SMART
DENN 90 271 4.8e-78 SMART
low complexity region 307 318 N/A INTRINSIC
Meta Mutation Damage Score 0.6349 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1B, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous KO results in enhanced allergic responses to aerosolized antigen challenges caused by delayed TCR down-modulation following receptor activation in T helper 2 cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3300002I08Rik A T 2: 150,344,644 D40E possibly damaging Het
4921517D22Rik C T 13: 59,689,533 R246H probably damaging Het
Agbl1 A G 7: 76,420,084 T203A probably benign Het
Alms1 T A 6: 85,623,074 D2096E probably damaging Het
Ankrd53 T C 6: 83,762,657 probably benign Het
Arap3 C A 18: 37,985,433 G814C probably damaging Het
Armc9 T G 1: 86,244,579 I5S probably benign Het
Catsperg1 T C 7: 29,210,695 T74A probably damaging Het
Ccpg1os C A 9: 72,979,988 C79F probably damaging Het
Cdca7l T A 12: 117,873,711 probably null Het
Cfhr2 T A 1: 139,805,415 probably benign Het
Chpt1 A G 10: 88,453,093 probably benign Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Col7a1 C T 9: 108,974,080 R2149C unknown Het
Cpa4 T C 6: 30,585,083 S289P probably damaging Het
Cpsf3 G A 12: 21,306,886 probably null Het
Creb3l1 T C 2: 91,992,005 H212R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2c29 A G 19: 39,321,609 D254G possibly damaging Het
Ddx58 T C 4: 40,229,551 I78V probably benign Het
Dhx29 T C 13: 112,964,571 L1216P probably damaging Het
Dsg1b T C 18: 20,396,419 I307T possibly damaging Het
Ep300 A G 15: 81,601,234 S141G unknown Het
Evl A C 12: 108,653,031 K101T probably damaging Het
Exph5 G A 9: 53,373,028 G470R probably benign Het
Fam126a T C 5: 23,966,369 S352G possibly damaging Het
Flg A T 3: 93,283,208 probably benign Het
Gm45704 T A 8: 72,784,292 Het
Grm1 T C 10: 11,079,896 M215V probably benign Het
Hadha T C 5: 30,140,996 D210G probably benign Het
Hmcn1 T C 1: 150,722,424 Y1709C probably damaging Het
Hrc A T 7: 45,336,733 H436L possibly damaging Het
Ido1 T A 8: 24,585,290 T259S possibly damaging Het
Itgb7 C A 15: 102,223,482 R222L probably benign Het
Khnyn T C 14: 55,887,839 V485A probably damaging Het
Kifc5b T C 17: 26,921,852 V100A probably benign Het
Lsm10 T C 4: 126,098,001 M50T probably damaging Het
Map3k6 T G 4: 133,245,675 W382G probably damaging Het
Mink1 T A 11: 70,610,652 F922I possibly damaging Het
Mpp5 T C 12: 78,824,789 V381A possibly damaging Het
Mrap2 T C 9: 87,175,818 V53A probably damaging Het
Mrps7 C A 11: 115,604,174 A5E probably benign Het
Muc4 A G 16: 32,766,924 N2713S possibly damaging Het
Nckipsd T C 9: 108,812,386 S249P probably damaging Het
Neil3 T C 8: 53,599,412 T384A probably benign Het
Noc3l A T 19: 38,798,955 I504K probably damaging Het
Nudt13 A G 14: 20,307,771 N107S probably benign Het
Olfr134 T A 17: 38,175,225 L47H probably damaging Het
Olfr368 T A 2: 37,332,113 M122K probably damaging Het
Olfr747 C A 14: 50,680,935 R233L probably benign Het
Otub1 G T 19: 7,199,153 Y205* probably null Het
Plpp7 T A 2: 32,096,088 S93T probably damaging Het
Pxk T G 14: 8,138,011 Y188D probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpap1 A T 2: 119,772,647 C602* probably null Het
Sbds T C 5: 130,246,344 K248E probably benign Het
Serpina10 A T 12: 103,628,833 N42K probably benign Het
Slc7a8 A G 14: 54,729,340 L368P probably damaging Het
Srrm1 T C 4: 135,337,873 probably benign Het
Sun2 C T 15: 79,730,332 V288I probably benign Het
Tas2r107 C A 6: 131,660,003 A28S possibly damaging Het
Tbc1d9b T C 11: 50,146,328 I268T probably benign Het
Tjp2 A G 19: 24,120,073 F495L probably damaging Het
Top2b T C 14: 16,423,740 L1434P possibly damaging Het
Top3b A G 16: 16,879,141 probably null Het
Trdv2-2 A T 14: 53,961,304 E17V possibly damaging Het
Ttc6 T A 12: 57,673,100 L819Q possibly damaging Het
Txlnb A G 10: 17,843,166 T582A probably benign Het
Zfp788 T C 7: 41,649,769 S558P probably damaging Het
Other mutations in Dennd1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Dennd1b APN 1 139062940 missense probably damaging 1.00
IGL00510:Dennd1b APN 1 139102071 missense probably damaging 1.00
IGL00671:Dennd1b APN 1 139133737 missense possibly damaging 0.94
IGL00937:Dennd1b APN 1 139170239 missense probably benign 0.01
IGL00959:Dennd1b APN 1 139143888 splice site probably benign
IGL01446:Dennd1b APN 1 139023110 missense possibly damaging 0.61
IGL01610:Dennd1b APN 1 139169766 utr 3 prime probably benign
IGL02275:Dennd1b APN 1 139081254 missense probably damaging 1.00
IGL02851:Dennd1b APN 1 139168967 utr 3 prime probably benign
IGL02995:Dennd1b APN 1 139081242 missense probably damaging 1.00
IGL03089:Dennd1b APN 1 139102029 missense possibly damaging 0.94
IGL03240:Dennd1b APN 1 139139392 missense possibly damaging 0.63
IGL03267:Dennd1b APN 1 139062861 nonsense probably null
Dendrite UTSW 1 139053417 critical splice donor site probably null
LCD18:Dennd1b UTSW 1 139114764 intron probably benign
PIT4418001:Dennd1b UTSW 1 139081261 missense
PIT4504001:Dennd1b UTSW 1 139040004 missense probably benign 0.28
R0426:Dennd1b UTSW 1 139170196 missense probably benign
R0445:Dennd1b UTSW 1 139167765 splice site probably benign
R0497:Dennd1b UTSW 1 139039986 splice site probably benign
R0627:Dennd1b UTSW 1 139081219 missense probably damaging 1.00
R1027:Dennd1b UTSW 1 139041962 missense probably damaging 1.00
R1599:Dennd1b UTSW 1 139167730 missense probably benign 0.01
R1703:Dennd1b UTSW 1 139169754 critical splice acceptor site probably null
R1844:Dennd1b UTSW 1 139090405 intron probably null
R1943:Dennd1b UTSW 1 139168952 utr 3 prime probably benign
R2504:Dennd1b UTSW 1 139170170 utr 3 prime probably benign
R2866:Dennd1b UTSW 1 139170281 missense possibly damaging 0.58
R3109:Dennd1b UTSW 1 139041916 splice site probably benign
R3843:Dennd1b UTSW 1 139053354 missense probably damaging 1.00
R3926:Dennd1b UTSW 1 139143959 missense probably benign 0.00
R4258:Dennd1b UTSW 1 139062940 missense probably damaging 1.00
R4504:Dennd1b UTSW 1 139085927 missense possibly damaging 0.82
R4805:Dennd1b UTSW 1 139053384 missense probably damaging 1.00
R4922:Dennd1b UTSW 1 139085914 missense probably damaging 0.99
R4954:Dennd1b UTSW 1 139053386 missense probably damaging 1.00
R5098:Dennd1b UTSW 1 139133721 missense probably damaging 0.97
R5205:Dennd1b UTSW 1 139054568 missense probably benign 0.00
R5240:Dennd1b UTSW 1 139062877 missense probably damaging 1.00
R5383:Dennd1b UTSW 1 139167671 missense probably benign
R5504:Dennd1b UTSW 1 139090508 missense probably benign 0.07
R5702:Dennd1b UTSW 1 139133675 missense probably damaging 1.00
R5801:Dennd1b UTSW 1 139039989 splice site probably null
R6190:Dennd1b UTSW 1 139133675 missense probably damaging 1.00
R6192:Dennd1b UTSW 1 139167718 missense probably benign 0.00
R6289:Dennd1b UTSW 1 139168945 utr 3 prime probably benign
R6453:Dennd1b UTSW 1 139143948 missense probably benign 0.07
R6479:Dennd1b UTSW 1 139041960 intron probably benign
R6940:Dennd1b UTSW 1 139053417 critical splice donor site probably null
R6954:Dennd1b UTSW 1 139168945 utr 3 prime probably benign
R7183:Dennd1b UTSW 1 139170252 missense unknown
R7710:Dennd1b UTSW 1 139062932 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACTCATCCATGATACCTGG -3'
(R):5'- ACCCTTGTGAAATCTTTGTGCC -3'

Sequencing Primer
(F):5'- CATGATACCTGGAACATGCCTTTGTG -3'
(R):5'- GCAAAATTTAAAGAACTATGCTTGCC -3'
Posted On2017-10-10