Incidental Mutation 'R6144:Nckipsd'
ID 488745
Institutional Source Beutler Lab
Gene Symbol Nckipsd
Ensembl Gene ENSMUSG00000032598
Gene Name NCK interacting protein with SH3 domain
Synonyms ORF1, DIP1, Wasbp, SPIN90, AF3P21, WISH
MMRRC Submission 044291-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.438) question?
Stock # R6144 (G1)
Quality Score 218.009
Status Validated
Chromosome 9
Chromosomal Location 108685567-108696043 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108689585 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 249 (S249P)
Ref Sequence ENSEMBL: ENSMUSP00000035218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035218] [ENSMUST00000194819] [ENSMUST00000195323]
AlphaFold Q9ESJ4
Predicted Effect probably damaging
Transcript: ENSMUST00000035218
AA Change: S249P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035218
Gene: ENSMUSG00000032598
AA Change: S249P

DomainStartEndE-ValueType
SH3 1 57 2.21e-9 SMART
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 230 240 N/A INTRINSIC
low complexity region 249 271 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Pfam:DUF2013 539 675 5e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192180
Predicted Effect probably benign
Transcript: ENSMUST00000192678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194413
Predicted Effect probably benign
Transcript: ENSMUST00000194819
SMART Domains Protein: ENSMUSP00000141702
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 52 3.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195323
SMART Domains Protein: ENSMUSP00000141728
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 57 1.4e-11 SMART
Meta Mutation Damage Score 0.0803 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized exclusively in the cell nucleus. It plays a role in signal transduction, and may function in the maintenance of sarcomeres and in the assembly of myofibrils into sarcomeres. It also plays an important role in stress fiber formation. The gene is involved in therapy-related leukemia by a chromosomal translocation t(3;11)(p21;q23) that involves this gene and the myeloid/lymphoid leukemia gene. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation exhibit altered protein composition of postsynaptic densities and actin cytoskeleton in hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3300002I08Rik A T 2: 150,186,564 (GRCm39) D40E possibly damaging Het
4921517D22Rik C T 13: 59,837,347 (GRCm39) R246H probably damaging Het
Agbl1 A G 7: 76,069,832 (GRCm39) T203A probably benign Het
Alms1 T A 6: 85,600,056 (GRCm39) D2096E probably damaging Het
Ankrd53 T C 6: 83,739,639 (GRCm39) probably benign Het
Arap3 C A 18: 38,118,486 (GRCm39) G814C probably damaging Het
Armc9 T G 1: 86,172,301 (GRCm39) I5S probably benign Het
Catsperg1 T C 7: 28,910,120 (GRCm39) T74A probably damaging Het
Cdca7l T A 12: 117,837,446 (GRCm39) probably null Het
Cfhr2 T A 1: 139,733,153 (GRCm39) probably benign Het
Chpt1 A G 10: 88,288,955 (GRCm39) probably benign Het
Cntrl A C 2: 35,055,745 (GRCm39) D1213A possibly damaging Het
Col7a1 C T 9: 108,803,148 (GRCm39) R2149C unknown Het
Cpa4 T C 6: 30,585,082 (GRCm39) S289P probably damaging Het
Cpsf3 G A 12: 21,356,887 (GRCm39) probably null Het
Creb3l1 T C 2: 91,822,350 (GRCm39) H212R possibly damaging Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
Cyp2c29 A G 19: 39,310,053 (GRCm39) D254G possibly damaging Het
Dennd1b A G 1: 139,008,993 (GRCm39) H232R probably damaging Het
Dhx29 T C 13: 113,101,105 (GRCm39) L1216P probably damaging Het
Dsg1b T C 18: 20,529,476 (GRCm39) I307T possibly damaging Het
Ep300 A G 15: 81,485,435 (GRCm39) S141G unknown Het
Evl A C 12: 108,619,290 (GRCm39) K101T probably damaging Het
Exph5 G A 9: 53,284,328 (GRCm39) G470R probably benign Het
Flg A T 3: 93,190,515 (GRCm39) probably benign Het
Gm45704 T A 8: 73,510,920 (GRCm39) Het
Grm1 T C 10: 10,955,640 (GRCm39) M215V probably benign Het
Hadha T C 5: 30,345,994 (GRCm39) D210G probably benign Het
Hmcn1 T C 1: 150,598,175 (GRCm39) Y1709C probably damaging Het
Hrc A T 7: 44,986,157 (GRCm39) H436L possibly damaging Het
Hycc1 T C 5: 24,171,367 (GRCm39) S352G possibly damaging Het
Ido1 T A 8: 25,075,306 (GRCm39) T259S possibly damaging Het
Itgb7 C A 15: 102,131,917 (GRCm39) R222L probably benign Het
Khnyn T C 14: 56,125,296 (GRCm39) V485A probably damaging Het
Kifc5b T C 17: 27,140,826 (GRCm39) V100A probably benign Het
Lsm10 T C 4: 125,991,794 (GRCm39) M50T probably damaging Het
Map3k6 T G 4: 132,972,986 (GRCm39) W382G probably damaging Het
Mink1 T A 11: 70,501,478 (GRCm39) F922I possibly damaging Het
Mrap2 T C 9: 87,057,871 (GRCm39) V53A probably damaging Het
Mrps7 C A 11: 115,495,000 (GRCm39) A5E probably benign Het
Muc4 A G 16: 32,587,298 (GRCm39) N2713S possibly damaging Het
Neil3 T C 8: 54,052,447 (GRCm39) T384A probably benign Het
Noc3l A T 19: 38,787,399 (GRCm39) I504K probably damaging Het
Nudt13 A G 14: 20,357,839 (GRCm39) N107S probably benign Het
Or11h4b C A 14: 50,918,392 (GRCm39) R233L probably benign Het
Or2n1 T A 17: 38,486,116 (GRCm39) L47H probably damaging Het
Or5c1 T A 2: 37,222,125 (GRCm39) M122K probably damaging Het
Otub1 G T 19: 7,176,518 (GRCm39) Y205* probably null Het
Pals1 T C 12: 78,871,563 (GRCm39) V381A possibly damaging Het
Pierce2 C A 9: 72,887,270 (GRCm39) C79F probably damaging Het
Plpp7 T A 2: 31,986,100 (GRCm39) S93T probably damaging Het
Pxk T G 14: 8,138,011 (GRCm38) Y188D probably damaging Het
Rigi T C 4: 40,229,551 (GRCm39) I78V probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rpap1 A T 2: 119,603,128 (GRCm39) C602* probably null Het
Sbds T C 5: 130,275,185 (GRCm39) K248E probably benign Het
Serpina10 A T 12: 103,595,092 (GRCm39) N42K probably benign Het
Slc7a8 A G 14: 54,966,797 (GRCm39) L368P probably damaging Het
Srrm1 T C 4: 135,065,184 (GRCm39) probably benign Het
Sun2 C T 15: 79,614,533 (GRCm39) V288I probably benign Het
Tas2r107 C A 6: 131,636,966 (GRCm39) A28S possibly damaging Het
Tbc1d9b T C 11: 50,037,155 (GRCm39) I268T probably benign Het
Tjp2 A G 19: 24,097,437 (GRCm39) F495L probably damaging Het
Top2b T C 14: 16,423,740 (GRCm38) L1434P possibly damaging Het
Top3b A G 16: 16,697,005 (GRCm39) probably null Het
Trdv2-2 A T 14: 54,198,761 (GRCm39) E17V possibly damaging Het
Ttc6 T A 12: 57,719,886 (GRCm39) L819Q possibly damaging Het
Txlnb A G 10: 17,718,914 (GRCm39) T582A probably benign Het
Zfp788 T C 7: 41,299,193 (GRCm39) S558P probably damaging Het
Other mutations in Nckipsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Nckipsd APN 9 108,692,168 (GRCm39) missense probably benign 0.07
IGL01601:Nckipsd APN 9 108,691,154 (GRCm39) missense probably benign 0.00
IGL01809:Nckipsd APN 9 108,694,753 (GRCm39) missense probably damaging 1.00
IGL03229:Nckipsd APN 9 108,688,813 (GRCm39) missense probably benign
R0714:Nckipsd UTSW 9 108,691,333 (GRCm39) unclassified probably benign
R1323:Nckipsd UTSW 9 108,689,778 (GRCm39) missense probably damaging 1.00
R1323:Nckipsd UTSW 9 108,689,778 (GRCm39) missense probably damaging 1.00
R1543:Nckipsd UTSW 9 108,689,571 (GRCm39) missense possibly damaging 0.62
R1958:Nckipsd UTSW 9 108,691,863 (GRCm39) splice site probably null
R2127:Nckipsd UTSW 9 108,688,932 (GRCm39) missense probably benign
R3697:Nckipsd UTSW 9 108,688,320 (GRCm39) missense probably damaging 1.00
R3698:Nckipsd UTSW 9 108,688,320 (GRCm39) missense probably damaging 1.00
R3921:Nckipsd UTSW 9 108,691,275 (GRCm39) missense possibly damaging 0.81
R4755:Nckipsd UTSW 9 108,691,938 (GRCm39) missense probably benign 0.28
R4879:Nckipsd UTSW 9 108,691,114 (GRCm39) unclassified probably benign
R5796:Nckipsd UTSW 9 108,688,813 (GRCm39) missense probably benign
R5891:Nckipsd UTSW 9 108,685,808 (GRCm39) missense probably damaging 1.00
R5943:Nckipsd UTSW 9 108,689,435 (GRCm39) missense possibly damaging 0.54
R5994:Nckipsd UTSW 9 108,691,176 (GRCm39) missense probably benign 0.00
R6403:Nckipsd UTSW 9 108,688,882 (GRCm39) missense possibly damaging 0.71
R7413:Nckipsd UTSW 9 108,691,280 (GRCm39) missense probably benign 0.30
R7676:Nckipsd UTSW 9 108,692,153 (GRCm39) missense probably damaging 1.00
R7702:Nckipsd UTSW 9 108,691,216 (GRCm39) nonsense probably null
R7893:Nckipsd UTSW 9 108,692,588 (GRCm39) missense probably damaging 1.00
R8257:Nckipsd UTSW 9 108,692,127 (GRCm39) missense probably benign 0.10
R9327:Nckipsd UTSW 9 108,691,699 (GRCm39) missense possibly damaging 0.49
R9353:Nckipsd UTSW 9 108,691,471 (GRCm39) missense probably damaging 0.99
R9484:Nckipsd UTSW 9 108,689,837 (GRCm39) missense probably damaging 1.00
Y4335:Nckipsd UTSW 9 108,694,744 (GRCm39) missense probably damaging 1.00
Z1088:Nckipsd UTSW 9 108,691,876 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACTTCTTGTTCACAGGTGGCC -3'
(R):5'- TCATGGCTTAGACCGGTGTTTC -3'

Sequencing Primer
(F):5'- CGCACAGCCATACCCTCTGG -3'
(R):5'- GCACGAGTTCCATCAGCTCTG -3'
Posted On 2017-10-10