Incidental Mutation 'R6144:Mpp5'
ID488755
Institutional Source Beutler Lab
Gene Symbol Mpp5
Ensembl Gene ENSMUSG00000021112
Gene Namemembrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
SynonymsPals1, 3830420B02Rik
MMRRC Submission 044291-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.652) question?
Stock #R6144 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location78748907-78840714 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78824789 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 381 (V381A)
Ref Sequence ENSEMBL: ENSMUSP00000080683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082024] [ENSMUST00000219197]
PDB Structure
Solution structure of the PDZ domain of Pals1 protein [SOLUTION NMR]
2.1 Angstrom crystal structure of the PALS-1-L27N and PATJ L27 heterodimer complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082024
AA Change: V381A

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080683
Gene: ENSMUSG00000021112
AA Change: V381A

DomainStartEndE-ValueType
coiled coil region 54 76 N/A INTRINSIC
L27 123 180 2.04e-10 SMART
L27 186 238 7.39e-8 SMART
PDZ 265 336 5.99e-13 SMART
SH3 348 416 1.2e-10 SMART
low complexity region 439 454 N/A INTRINSIC
GuKc 478 663 1.72e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218726
Predicted Effect probably benign
Transcript: ENSMUST00000219197
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the p55-like subfamily of the membrane-associated guanylate kinase (MAGUK) gene superfamily. The encoded protein participates in the polarization of differentiating cells, has been shown to regulate myelinating Schwann cells (PMID: 20237282), and is one of the components of the Crumbs complex in the retina. Mice which express lower levels of the orthologous protein have retinal degeneration and impaired vision (PMID: 22114289). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a floxed allele activated in cortical neuron exhibit loss of cortex neurons due to premature differentiation and increased apoptosis. These mice also exhibit behavioral defects but are otherwise viable and fertile. Heterozygous mice exhibit an intermediate phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3300002I08Rik A T 2: 150,344,644 D40E possibly damaging Het
4921517D22Rik C T 13: 59,689,533 R246H probably damaging Het
Agbl1 A G 7: 76,420,084 T203A probably benign Het
Alms1 T A 6: 85,623,074 D2096E probably damaging Het
Ankrd53 T C 6: 83,762,657 probably benign Het
Arap3 C A 18: 37,985,433 G814C probably damaging Het
Armc9 T G 1: 86,244,579 I5S probably benign Het
Catsperg1 T C 7: 29,210,695 T74A probably damaging Het
Ccpg1os C A 9: 72,979,988 C79F probably damaging Het
Cdca7l T A 12: 117,873,711 probably null Het
Cfhr2 T A 1: 139,805,415 probably benign Het
Chpt1 A G 10: 88,453,093 probably benign Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Col7a1 C T 9: 108,974,080 R2149C unknown Het
Cpa4 T C 6: 30,585,083 S289P probably damaging Het
Cpsf3 G A 12: 21,306,886 probably null Het
Creb3l1 T C 2: 91,992,005 H212R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2c29 A G 19: 39,321,609 D254G possibly damaging Het
Ddx58 T C 4: 40,229,551 I78V probably benign Het
Dennd1b A G 1: 139,081,255 H232R probably damaging Het
Dhx29 T C 13: 112,964,571 L1216P probably damaging Het
Dsg1b T C 18: 20,396,419 I307T possibly damaging Het
Ep300 A G 15: 81,601,234 S141G unknown Het
Evl A C 12: 108,653,031 K101T probably damaging Het
Exph5 G A 9: 53,373,028 G470R probably benign Het
Fam126a T C 5: 23,966,369 S352G possibly damaging Het
Flg A T 3: 93,283,208 probably benign Het
Gm45704 T A 8: 72,784,292 Het
Grm1 T C 10: 11,079,896 M215V probably benign Het
Hadha T C 5: 30,140,996 D210G probably benign Het
Hmcn1 T C 1: 150,722,424 Y1709C probably damaging Het
Hrc A T 7: 45,336,733 H436L possibly damaging Het
Ido1 T A 8: 24,585,290 T259S possibly damaging Het
Itgb7 C A 15: 102,223,482 R222L probably benign Het
Khnyn T C 14: 55,887,839 V485A probably damaging Het
Kifc5b T C 17: 26,921,852 V100A probably benign Het
Lsm10 T C 4: 126,098,001 M50T probably damaging Het
Map3k6 T G 4: 133,245,675 W382G probably damaging Het
Mink1 T A 11: 70,610,652 F922I possibly damaging Het
Mrap2 T C 9: 87,175,818 V53A probably damaging Het
Mrps7 C A 11: 115,604,174 A5E probably benign Het
Muc4 A G 16: 32,766,924 N2713S possibly damaging Het
Nckipsd T C 9: 108,812,386 S249P probably damaging Het
Neil3 T C 8: 53,599,412 T384A probably benign Het
Noc3l A T 19: 38,798,955 I504K probably damaging Het
Nudt13 A G 14: 20,307,771 N107S probably benign Het
Olfr134 T A 17: 38,175,225 L47H probably damaging Het
Olfr368 T A 2: 37,332,113 M122K probably damaging Het
Olfr747 C A 14: 50,680,935 R233L probably benign Het
Otub1 G T 19: 7,199,153 Y205* probably null Het
Plpp7 T A 2: 32,096,088 S93T probably damaging Het
Pxk T G 14: 8,138,011 Y188D probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpap1 A T 2: 119,772,647 C602* probably null Het
Sbds T C 5: 130,246,344 K248E probably benign Het
Serpina10 A T 12: 103,628,833 N42K probably benign Het
Slc7a8 A G 14: 54,729,340 L368P probably damaging Het
Srrm1 T C 4: 135,337,873 probably benign Het
Sun2 C T 15: 79,730,332 V288I probably benign Het
Tas2r107 C A 6: 131,660,003 A28S possibly damaging Het
Tbc1d9b T C 11: 50,146,328 I268T probably benign Het
Tjp2 A G 19: 24,120,073 F495L probably damaging Het
Top2b T C 14: 16,423,740 L1434P possibly damaging Het
Top3b A G 16: 16,879,141 probably null Het
Trdv2-2 A T 14: 53,961,304 E17V possibly damaging Het
Ttc6 T A 12: 57,673,100 L819Q possibly damaging Het
Txlnb A G 10: 17,843,166 T582A probably benign Het
Zfp788 T C 7: 41,649,769 S558P probably damaging Het
Other mutations in Mpp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Mpp5 APN 12 78829799 missense possibly damaging 0.89
IGL00863:Mpp5 APN 12 78809821 missense probably damaging 1.00
IGL01860:Mpp5 APN 12 78830907 missense possibly damaging 0.79
R1584:Mpp5 UTSW 12 78829727 missense probably benign 0.34
R1632:Mpp5 UTSW 12 78797038 nonsense probably null
R2117:Mpp5 UTSW 12 78809922 missense possibly damaging 0.81
R2186:Mpp5 UTSW 12 78819371 splice site probably benign
R2211:Mpp5 UTSW 12 78797248 missense possibly damaging 0.78
R4044:Mpp5 UTSW 12 78824839 missense probably benign 0.06
R4224:Mpp5 UTSW 12 78829718 missense probably damaging 1.00
R4535:Mpp5 UTSW 12 78824837 missense possibly damaging 0.90
R5157:Mpp5 UTSW 12 78820815 missense possibly damaging 0.95
R6180:Mpp5 UTSW 12 78817310 missense probably benign 0.11
R7037:Mpp5 UTSW 12 78797199 missense probably damaging 1.00
R7216:Mpp5 UTSW 12 78797232 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCTAACATGCTGTTGCTTAAC -3'
(R):5'- TTTGATTCCAGGCCTCTGCAG -3'

Sequencing Primer
(F):5'- CATGCTGTTGCTTAACTAAATGTCC -3'
(R):5'- GATTCCAGGCCTCTGCAGTTAAG -3'
Posted On2017-10-10