Incidental Mutation 'R6144:Dhx29'
ID488759
Institutional Source Beutler Lab
Gene Symbol Dhx29
Ensembl Gene ENSMUSG00000042426
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 29
SynonymsE130202M19Rik
MMRRC Submission 044291-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6144 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location112927454-112969432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112964571 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1216 (L1216P)
Ref Sequence ENSEMBL: ENSMUSP00000035244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038574]
Predicted Effect probably damaging
Transcript: ENSMUST00000038574
AA Change: L1216P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035244
Gene: ENSMUSG00000042426
AA Change: L1216P

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 209 225 N/A INTRINSIC
low complexity region 240 255 N/A INTRINSIC
coiled coil region 279 308 N/A INTRINSIC
low complexity region 343 358 N/A INTRINSIC
Blast:DEXDc 411 450 2e-14 BLAST
DEXDc 569 763 1.09e-27 SMART
low complexity region 846 856 N/A INTRINSIC
HELICc 880 985 6.1e-17 SMART
HA2 1047 1138 8.9e-26 SMART
Pfam:OB_NTP_bind 1178 1298 3.8e-19 PFAM
Meta Mutation Damage Score 0.9386 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein functions in translation initiation, and is specifically required for ribosomal scanning across stable mRNA secondary structures during initiation codon selection. This protein may also play a role in sensing virally derived cytosolic nucleic acids. Knockdown of this gene results in reduced protein translation and impaired proliferation of cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3300002I08Rik A T 2: 150,344,644 D40E possibly damaging Het
4921517D22Rik C T 13: 59,689,533 R246H probably damaging Het
Agbl1 A G 7: 76,420,084 T203A probably benign Het
Alms1 T A 6: 85,623,074 D2096E probably damaging Het
Ankrd53 T C 6: 83,762,657 probably benign Het
Arap3 C A 18: 37,985,433 G814C probably damaging Het
Armc9 T G 1: 86,244,579 I5S probably benign Het
Catsperg1 T C 7: 29,210,695 T74A probably damaging Het
Ccpg1os C A 9: 72,979,988 C79F probably damaging Het
Cdca7l T A 12: 117,873,711 probably null Het
Cfhr2 T A 1: 139,805,415 probably benign Het
Chpt1 A G 10: 88,453,093 probably benign Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Col7a1 C T 9: 108,974,080 R2149C unknown Het
Cpa4 T C 6: 30,585,083 S289P probably damaging Het
Cpsf3 G A 12: 21,306,886 probably null Het
Creb3l1 T C 2: 91,992,005 H212R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2c29 A G 19: 39,321,609 D254G possibly damaging Het
Ddx58 T C 4: 40,229,551 I78V probably benign Het
Dennd1b A G 1: 139,081,255 H232R probably damaging Het
Dsg1b T C 18: 20,396,419 I307T possibly damaging Het
Ep300 A G 15: 81,601,234 S141G unknown Het
Evl A C 12: 108,653,031 K101T probably damaging Het
Exph5 G A 9: 53,373,028 G470R probably benign Het
Fam126a T C 5: 23,966,369 S352G possibly damaging Het
Flg A T 3: 93,283,208 probably benign Het
Gm45704 T A 8: 72,784,292 Het
Grm1 T C 10: 11,079,896 M215V probably benign Het
Hadha T C 5: 30,140,996 D210G probably benign Het
Hmcn1 T C 1: 150,722,424 Y1709C probably damaging Het
Hrc A T 7: 45,336,733 H436L possibly damaging Het
Ido1 T A 8: 24,585,290 T259S possibly damaging Het
Itgb7 C A 15: 102,223,482 R222L probably benign Het
Khnyn T C 14: 55,887,839 V485A probably damaging Het
Kifc5b T C 17: 26,921,852 V100A probably benign Het
Lsm10 T C 4: 126,098,001 M50T probably damaging Het
Map3k6 T G 4: 133,245,675 W382G probably damaging Het
Mink1 T A 11: 70,610,652 F922I possibly damaging Het
Mpp5 T C 12: 78,824,789 V381A possibly damaging Het
Mrap2 T C 9: 87,175,818 V53A probably damaging Het
Mrps7 C A 11: 115,604,174 A5E probably benign Het
Muc4 A G 16: 32,766,924 N2713S possibly damaging Het
Nckipsd T C 9: 108,812,386 S249P probably damaging Het
Neil3 T C 8: 53,599,412 T384A probably benign Het
Noc3l A T 19: 38,798,955 I504K probably damaging Het
Nudt13 A G 14: 20,307,771 N107S probably benign Het
Olfr134 T A 17: 38,175,225 L47H probably damaging Het
Olfr368 T A 2: 37,332,113 M122K probably damaging Het
Olfr747 C A 14: 50,680,935 R233L probably benign Het
Otub1 G T 19: 7,199,153 Y205* probably null Het
Plpp7 T A 2: 32,096,088 S93T probably damaging Het
Pxk T G 14: 8,138,011 Y188D probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpap1 A T 2: 119,772,647 C602* probably null Het
Sbds T C 5: 130,246,344 K248E probably benign Het
Serpina10 A T 12: 103,628,833 N42K probably benign Het
Slc7a8 A G 14: 54,729,340 L368P probably damaging Het
Srrm1 T C 4: 135,337,873 probably benign Het
Sun2 C T 15: 79,730,332 V288I probably benign Het
Tas2r107 C A 6: 131,660,003 A28S possibly damaging Het
Tbc1d9b T C 11: 50,146,328 I268T probably benign Het
Tjp2 A G 19: 24,120,073 F495L probably damaging Het
Top2b T C 14: 16,423,740 L1434P possibly damaging Het
Top3b A G 16: 16,879,141 probably null Het
Trdv2-2 A T 14: 53,961,304 E17V possibly damaging Het
Ttc6 T A 12: 57,673,100 L819Q possibly damaging Het
Txlnb A G 10: 17,843,166 T582A probably benign Het
Zfp788 T C 7: 41,649,769 S558P probably damaging Het
Other mutations in Dhx29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Dhx29 APN 13 112964603 missense probably benign 0.15
IGL00434:Dhx29 APN 13 112955225 missense probably benign 0.00
IGL00659:Dhx29 APN 13 112966635 splice site probably benign
IGL01618:Dhx29 APN 13 112965222 missense probably damaging 1.00
IGL01777:Dhx29 APN 13 112930872 missense probably benign 0.42
IGL02010:Dhx29 APN 13 112966634 critical splice donor site probably null
IGL02125:Dhx29 APN 13 112955300 splice site probably benign
IGL02324:Dhx29 APN 13 112927808 missense probably damaging 1.00
IGL02801:Dhx29 APN 13 112964646 missense probably damaging 1.00
R0001:Dhx29 UTSW 13 112964556 missense probably damaging 0.99
R0362:Dhx29 UTSW 13 112962859 missense probably benign
R0468:Dhx29 UTSW 13 112963277 missense probably benign
R0569:Dhx29 UTSW 13 112948214 missense probably benign 0.01
R0714:Dhx29 UTSW 13 112927965 missense possibly damaging 0.55
R1460:Dhx29 UTSW 13 112965210 splice site probably benign
R1579:Dhx29 UTSW 13 112935598 critical splice donor site probably null
R1657:Dhx29 UTSW 13 112952843 missense probably damaging 1.00
R1735:Dhx29 UTSW 13 112945086 missense probably benign 0.00
R1768:Dhx29 UTSW 13 112948240 missense probably damaging 1.00
R1851:Dhx29 UTSW 13 112948281 missense probably damaging 1.00
R1937:Dhx29 UTSW 13 112965330 missense probably benign 0.06
R2180:Dhx29 UTSW 13 112962872 critical splice donor site probably null
R2219:Dhx29 UTSW 13 112952804 missense probably damaging 1.00
R2442:Dhx29 UTSW 13 112946974 missense possibly damaging 0.94
R2679:Dhx29 UTSW 13 112947376 critical splice donor site probably null
R2908:Dhx29 UTSW 13 112927851 missense possibly damaging 0.78
R2912:Dhx29 UTSW 13 112935575 missense probably damaging 1.00
R3414:Dhx29 UTSW 13 112947273 missense probably damaging 0.99
R3931:Dhx29 UTSW 13 112958965 missense probably damaging 1.00
R3957:Dhx29 UTSW 13 112930921 missense probably benign
R4065:Dhx29 UTSW 13 112964742 critical splice donor site probably null
R4207:Dhx29 UTSW 13 112927949 missense probably benign 0.01
R4422:Dhx29 UTSW 13 112947247 missense probably damaging 1.00
R4717:Dhx29 UTSW 13 112946935 missense unknown
R4718:Dhx29 UTSW 13 112946935 missense unknown
R5125:Dhx29 UTSW 13 112932600 missense possibly damaging 0.81
R5178:Dhx29 UTSW 13 112932600 missense possibly damaging 0.81
R5263:Dhx29 UTSW 13 112948221 missense probably damaging 1.00
R5458:Dhx29 UTSW 13 112966621 missense probably benign 0.00
R5469:Dhx29 UTSW 13 112944539 missense possibly damaging 0.94
R5541:Dhx29 UTSW 13 112940374 missense possibly damaging 0.47
R5573:Dhx29 UTSW 13 112933215 missense probably benign 0.07
R5664:Dhx29 UTSW 13 112946879 missense probably damaging 1.00
R5682:Dhx29 UTSW 13 112930849 missense probably damaging 1.00
R5769:Dhx29 UTSW 13 112953717 missense probably damaging 0.99
R5917:Dhx29 UTSW 13 112962843 missense probably damaging 1.00
R5928:Dhx29 UTSW 13 112964468 missense probably benign 0.00
R6115:Dhx29 UTSW 13 112952801 critical splice acceptor site probably null
R6195:Dhx29 UTSW 13 112964537 missense probably benign 0.08
R6233:Dhx29 UTSW 13 112964537 missense probably benign 0.08
R6430:Dhx29 UTSW 13 112944619 missense possibly damaging 0.77
R6480:Dhx29 UTSW 13 112953788 nonsense probably null
R6527:Dhx29 UTSW 13 112932542 missense probably damaging 1.00
R6856:Dhx29 UTSW 13 112952861 missense probably benign 0.43
R7391:Dhx29 UTSW 13 112962859 missense probably benign
R7555:Dhx29 UTSW 13 112927642 start gained probably benign
R7602:Dhx29 UTSW 13 112944559 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCGTGGTCATTTCTCTAATCG -3'
(R):5'- ATTAGGTCACCAGAGCGTGTTAG -3'

Sequencing Primer
(F):5'- CGTGGTCATTTCTCTAATCGATTATG -3'
(R):5'- GGATTGCAGAAAGAGCCTTTACCTTC -3'
Posted On2017-10-10