Incidental Mutation 'R6144:Top2b'
ID488761
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Nametopoisomerase (DNA) II beta
SynonymsD230016L12Rik, Top-2
MMRRC Submission 044291-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R6144 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location16365179-16435462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16423740 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1434 (L1434P)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000161693]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017629
AA Change: L1434P

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: L1434P

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000161693
AA Change: L308P
SMART Domains Protein: ENSMUSP00000123992
Gene: ENSMUSG00000017485
AA Change: L308P

DomainStartEndE-ValueType
Pfam:DNA_topoisoIV 1 117 1.2e-12 PFAM
low complexity region 161 173 N/A INTRINSIC
low complexity region 198 210 N/A INTRINSIC
low complexity region 234 256 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224695
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3300002I08Rik A T 2: 150,344,644 D40E possibly damaging Het
4921517D22Rik C T 13: 59,689,533 R246H probably damaging Het
Agbl1 A G 7: 76,420,084 T203A probably benign Het
Alms1 T A 6: 85,623,074 D2096E probably damaging Het
Ankrd53 T C 6: 83,762,657 probably benign Het
Arap3 C A 18: 37,985,433 G814C probably damaging Het
Armc9 T G 1: 86,244,579 I5S probably benign Het
Catsperg1 T C 7: 29,210,695 T74A probably damaging Het
Ccpg1os C A 9: 72,979,988 C79F probably damaging Het
Cdca7l T A 12: 117,873,711 probably null Het
Cfhr2 T A 1: 139,805,415 probably benign Het
Chpt1 A G 10: 88,453,093 probably benign Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Col7a1 C T 9: 108,974,080 R2149C unknown Het
Cpa4 T C 6: 30,585,083 S289P probably damaging Het
Cpsf3 G A 12: 21,306,886 probably null Het
Creb3l1 T C 2: 91,992,005 H212R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2c29 A G 19: 39,321,609 D254G possibly damaging Het
Ddx58 T C 4: 40,229,551 I78V probably benign Het
Dennd1b A G 1: 139,081,255 H232R probably damaging Het
Dhx29 T C 13: 112,964,571 L1216P probably damaging Het
Dsg1b T C 18: 20,396,419 I307T possibly damaging Het
Ep300 A G 15: 81,601,234 S141G unknown Het
Evl A C 12: 108,653,031 K101T probably damaging Het
Exph5 G A 9: 53,373,028 G470R probably benign Het
Fam126a T C 5: 23,966,369 S352G possibly damaging Het
Flg A T 3: 93,283,208 probably benign Het
Gm45704 T A 8: 72,784,292 Het
Grm1 T C 10: 11,079,896 M215V probably benign Het
Hadha T C 5: 30,140,996 D210G probably benign Het
Hmcn1 T C 1: 150,722,424 Y1709C probably damaging Het
Hrc A T 7: 45,336,733 H436L possibly damaging Het
Ido1 T A 8: 24,585,290 T259S possibly damaging Het
Itgb7 C A 15: 102,223,482 R222L probably benign Het
Khnyn T C 14: 55,887,839 V485A probably damaging Het
Kifc5b T C 17: 26,921,852 V100A probably benign Het
Lsm10 T C 4: 126,098,001 M50T probably damaging Het
Map3k6 T G 4: 133,245,675 W382G probably damaging Het
Mink1 T A 11: 70,610,652 F922I possibly damaging Het
Mpp5 T C 12: 78,824,789 V381A possibly damaging Het
Mrap2 T C 9: 87,175,818 V53A probably damaging Het
Mrps7 C A 11: 115,604,174 A5E probably benign Het
Muc4 A G 16: 32,766,924 N2713S possibly damaging Het
Nckipsd T C 9: 108,812,386 S249P probably damaging Het
Neil3 T C 8: 53,599,412 T384A probably benign Het
Noc3l A T 19: 38,798,955 I504K probably damaging Het
Nudt13 A G 14: 20,307,771 N107S probably benign Het
Olfr134 T A 17: 38,175,225 L47H probably damaging Het
Olfr368 T A 2: 37,332,113 M122K probably damaging Het
Olfr747 C A 14: 50,680,935 R233L probably benign Het
Otub1 G T 19: 7,199,153 Y205* probably null Het
Plpp7 T A 2: 32,096,088 S93T probably damaging Het
Pxk T G 14: 8,138,011 Y188D probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpap1 A T 2: 119,772,647 C602* probably null Het
Sbds T C 5: 130,246,344 K248E probably benign Het
Serpina10 A T 12: 103,628,833 N42K probably benign Het
Slc7a8 A G 14: 54,729,340 L368P probably damaging Het
Srrm1 T C 4: 135,337,873 probably benign Het
Sun2 C T 15: 79,730,332 V288I probably benign Het
Tas2r107 C A 6: 131,660,003 A28S possibly damaging Het
Tbc1d9b T C 11: 50,146,328 I268T probably benign Het
Tjp2 A G 19: 24,120,073 F495L probably damaging Het
Top3b A G 16: 16,879,141 probably null Het
Trdv2-2 A T 14: 53,961,304 E17V possibly damaging Het
Ttc6 T A 12: 57,673,100 L819Q possibly damaging Het
Txlnb A G 10: 17,843,166 T582A probably benign Het
Zfp788 T C 7: 41,649,769 S558P probably damaging Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16422692 missense probably benign 0.00
IGL00730:Top2b APN 14 16389831 missense probably damaging 1.00
IGL00917:Top2b APN 14 16407354 missense probably benign 0.05
IGL01959:Top2b APN 14 16422695 missense probably benign 0.19
IGL02019:Top2b APN 14 16409965 missense probably benign 0.44
IGL02119:Top2b APN 14 16406733 missense probably damaging 1.00
IGL02136:Top2b APN 14 16407103 unclassified probably benign
IGL02148:Top2b APN 14 16400488 missense probably damaging 1.00
IGL02496:Top2b APN 14 16387335 missense probably benign
IGL02503:Top2b APN 14 16407163 missense possibly damaging 0.92
IGL02672:Top2b APN 14 16409166 unclassified probably benign
IGL02721:Top2b APN 14 16409236 missense probably damaging 1.00
IGL02886:Top2b APN 14 16365688 missense possibly damaging 0.73
IGL03252:Top2b APN 14 16393163 missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16423780 critical splice donor site probably null
R0092:Top2b UTSW 14 16409263 missense probably damaging 1.00
R0201:Top2b UTSW 14 16383174 missense probably damaging 1.00
R0390:Top2b UTSW 14 16418442 missense probably benign 0.00
R0394:Top2b UTSW 14 16413556 splice site probably null
R1159:Top2b UTSW 14 16430329 missense possibly damaging 0.81
R1424:Top2b UTSW 14 16383177 missense probably damaging 1.00
R1519:Top2b UTSW 14 16408953 splice site probably null
R1561:Top2b UTSW 14 16398993 missense possibly damaging 0.80
R1713:Top2b UTSW 14 16409823 missense probably benign 0.05
R1987:Top2b UTSW 14 16398916 missense probably damaging 0.99
R2219:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2287:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2422:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2679:Top2b UTSW 14 16413947 missense probably damaging 1.00
R3687:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3707:Top2b UTSW 14 16388447 missense probably damaging 1.00
R3810:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3812:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3815:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3816:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3818:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4023:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4025:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4026:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4133:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4157:Top2b UTSW 14 16384491 missense probably benign 0.42
R4179:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4180:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4300:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4376:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4377:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4492:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4549:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4550:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4581:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4582:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4628:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4630:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4667:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4668:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4669:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4698:Top2b UTSW 14 16387331 nonsense probably null
R4769:Top2b UTSW 14 16398991 missense probably damaging 1.00
R4809:Top2b UTSW 14 16383125 missense probably benign 0.06
R4899:Top2b UTSW 14 16387313 missense probably damaging 1.00
R5035:Top2b UTSW 14 16409966 missense probably benign 0.01
R5621:Top2b UTSW 14 16387280 missense probably damaging 1.00
R5631:Top2b UTSW 14 16409882 missense probably damaging 1.00
R5685:Top2b UTSW 14 16413666 missense probably damaging 1.00
R5732:Top2b UTSW 14 16400106 missense possibly damaging 0.92
R5939:Top2b UTSW 14 16422786 missense probably damaging 0.96
R6007:Top2b UTSW 14 16423779 critical splice donor site probably null
R6087:Top2b UTSW 14 16409864 missense probably benign 0.14
R6196:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6218:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6229:Top2b UTSW 14 16409838 missense probably damaging 1.00
R6249:Top2b UTSW 14 16399006 missense probably damaging 1.00
R6337:Top2b UTSW 14 16399026 missense possibly damaging 0.77
R6353:Top2b UTSW 14 16416671 missense probably damaging 1.00
R6512:Top2b UTSW 14 16409854 missense possibly damaging 0.94
R6573:Top2b UTSW 14 16398991 missense probably damaging 1.00
R6614:Top2b UTSW 14 16407142 nonsense probably null
R6844:Top2b UTSW 14 16429383 missense possibly damaging 0.94
R6848:Top2b UTSW 14 16409958 missense possibly damaging 0.89
R6871:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6895:Top2b UTSW 14 16413604 missense probably benign 0.06
R7162:Top2b UTSW 14 16416653 missense probably benign 0.00
R7247:Top2b UTSW 14 16416962 missense probably benign 0.08
R7250:Top2b UTSW 14 16420411 missense probably benign
R7359:Top2b UTSW 14 16407376 missense probably null 1.00
R7365:Top2b UTSW 14 16416649 missense probably benign 0.04
R7493:Top2b UTSW 14 16416605 missense probably benign 0.00
R7528:Top2b UTSW 14 16395427 nonsense probably null
R7562:Top2b UTSW 14 16412946 missense probably benign 0.04
X0028:Top2b UTSW 14 16384499 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGAGTCCACCTTTCTCTTTGAAG -3'
(R):5'- TATTGGGCAAAGTGTAGTCTTTCAC -3'

Sequencing Primer
(F):5'- TGAATAATTTCAAACCATTGCCTGG -3'
(R):5'- GGGCAAAGTGTAGTCTTTCACTAATG -3'
Posted On2017-10-10