Mutagenetix > Incidental Mutations

Incidental Mutation 'R6144:Arap3'

488774

Institutional Source

Beutler Lab

Gene Symbol

Arap3

Ensembl Gene

ENSMUSG00000024451

Gene Name

ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3

Synonyms

DRAG1, E030006K04Rik, Centd3

MMRRC Submission

044291-MU

Accession Numbers

NCBI RefSeq: NM_139206.2, NM_001205336.1; MGI:2147274

Is this an essential gene?

Possibly essential (E-score: 0.748) question?

Stock #

R6144 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

37972624-37997574 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 37985433 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 814 (G814C)

Ref Sequence

ENSEMBL: ENSMUSP00000035662 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042944]

Predicted Effect

probably damaging
Transcript: ENSMUST00000042944
AA Change: G814C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000035662
Gene: ENSMUSG00000024451
AA Change: G814C

Domain	Start	End	E-Value	Type
SAM	1	68	1.5e-7	SMART
low complexity region	81	98	N/A	INTRINSIC
low complexity region	134	142	N/A	INTRINSIC
PH	283	376	3.4e-16	SMART
PH	390	480	1.61e-8	SMART
ArfGap	484	606	1.44e-25	SMART
low complexity region	642	661	N/A	INTRINSIC
PH	671	785	2.86e1	SMART
PH	795	901	6.87e-3	SMART
RhoGAP	913	1089	2.11e-47	SMART
Pfam:RA	1113	1206	6.2e-16	PFAM
PH	1220	1323	3.46e-8	SMART
low complexity region	1388	1407	N/A	INTRINSIC
low complexity region	1457	1469	N/A	INTRINSIC
low complexity region	1475	1486	N/A	INTRINSIC
low complexity region	1494	1529	N/A	INTRINSIC

Meta Mutation Damage Score

0.1434

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

96% (65/68)

MGI Phenotype

Strain: 5428754
Lethality: E10-E11
FUNCTION: This gene encodes a phosphoinositide binding protein containing ARF-GAP, RHO-GAP, RAS-associating, and pleckstrin homology domains. The ARF-GAP and RHO-GAP domains cooperate in mediating rearrangements in the cell cytoskeleton and cell shape. It is a specific PtdIns(3,4,5)P3/PtdIns(3,4)P2-stimulated Arf6-GAP protein. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele die around E11 exhibiting pallor, embryonic growth arrest, yolk sac and placental abnormalities, and an endothelial cell-autonomous defect in sprouting angiogenesis. Knock-in mice homozygous for a point mutation display similar angiogenesis defects. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3300002I08Rik	A	T	2: 150,344,644	D40E	possibly damaging	Het
4921517D22Rik	C	T	13: 59,689,533	R246H	probably damaging	Het
Agbl1	A	G	7: 76,420,084	T203A	probably benign	Het
Alms1	T	A	6: 85,623,074	D2096E	probably damaging	Het
Ankrd53	T	C	6: 83,762,657		probably benign	Het
Armc9	T	G	1: 86,244,579	I5S	probably benign	Het
Catsperg1	T	C	7: 29,210,695	T74A	probably damaging	Het
Ccpg1os	C	A	9: 72,979,988	C79F	probably damaging	Het
Cdca7l	T	A	12: 117,873,711		probably null	Het
Cfhr2	T	A	1: 139,805,415		probably benign	Het
Chpt1	A	G	10: 88,453,093		probably benign	Het
Cntrl	A	C	2: 35,165,733	D1213A	possibly damaging	Het
Col7a1	C	T	9: 108,974,080	R2149C	unknown	Het
Cpa4	T	C	6: 30,585,083	S289P	probably damaging	Het
Cpsf3	G	A	12: 21,306,886		probably null	Het
Creb3l1	T	C	2: 91,992,005	H212R	possibly damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Cyp2c29	A	G	19: 39,321,609	D254G	possibly damaging	Het
Ddx58	T	C	4: 40,229,551	I78V	probably benign	Het
Dennd1b	A	G	1: 139,081,255	H232R	probably damaging	Het
Dhx29	T	C	13: 112,964,571	L1216P	probably damaging	Het
Dsg1b	T	C	18: 20,396,419	I307T	possibly damaging	Het
Ep300	A	G	15: 81,601,234	S141G	unknown	Het
Evl	A	C	12: 108,653,031	K101T	probably damaging	Het
Exph5	G	A	9: 53,373,028	G470R	probably benign	Het
Fam126a	T	C	5: 23,966,369	S352G	possibly damaging	Het
Flg	A	T	3: 93,283,208		probably benign	Het
Gm45704	T	A	8: 72,784,292			Het
Grm1	T	C	10: 11,079,896	M215V	probably benign	Het
Hadha	T	C	5: 30,140,996	D210G	probably benign	Het
Hmcn1	T	C	1: 150,722,424	Y1709C	probably damaging	Het
Hrc	A	T	7: 45,336,733	H436L	possibly damaging	Het
Ido1	T	A	8: 24,585,290	T259S	possibly damaging	Het
Itgb7	C	A	15: 102,223,482	R222L	probably benign	Het
Khnyn	T	C	14: 55,887,839	V485A	probably damaging	Het
Kifc5b	T	C	17: 26,921,852	V100A	probably benign	Het
Lsm10	T	C	4: 126,098,001	M50T	probably damaging	Het
Map3k6	T	G	4: 133,245,675	W382G	probably damaging	Het
Mink1	T	A	11: 70,610,652	F922I	possibly damaging	Het
Mpp5	T	C	12: 78,824,789	V381A	possibly damaging	Het
Mrap2	T	C	9: 87,175,818	V53A	probably damaging	Het
Mrps7	C	A	11: 115,604,174	A5E	probably benign	Het
Muc4	A	G	16: 32,766,924	N2713S	possibly damaging	Het
Nckipsd	T	C	9: 108,812,386	S249P	probably damaging	Het
Neil3	T	C	8: 53,599,412	T384A	probably benign	Het
Noc3l	A	T	19: 38,798,955	I504K	probably damaging	Het
Nudt13	A	G	14: 20,307,771	N107S	probably benign	Het
Olfr134	T	A	17: 38,175,225	L47H	probably damaging	Het
Olfr368	T	A	2: 37,332,113	M122K	probably damaging	Het
Olfr747	C	A	14: 50,680,935	R233L	probably benign	Het
Otub1	G	T	19: 7,199,153	Y205*	probably null	Het
Plpp7	T	A	2: 32,096,088	S93T	probably damaging	Het
Pxk	T	G	14: 8,138,011	Y188D	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rpap1	A	T	2: 119,772,647	C602*	probably null	Het
Sbds	T	C	5: 130,246,344	K248E	probably benign	Het
Serpina10	A	T	12: 103,628,833	N42K	probably benign	Het
Slc7a8	A	G	14: 54,729,340	L368P	probably damaging	Het
Srrm1	T	C	4: 135,337,873		probably benign	Het
Sun2	C	T	15: 79,730,332	V288I	probably benign	Het
Tas2r107	C	A	6: 131,660,003	A28S	possibly damaging	Het
Tbc1d9b	T	C	11: 50,146,328	I268T	probably benign	Het
Tjp2	A	G	19: 24,120,073	F495L	probably damaging	Het
Top2b	T	C	14: 16,423,740	L1434P	possibly damaging	Het
Top3b	A	G	16: 16,879,141		probably null	Het
Trdv2-2	A	T	14: 53,961,304	E17V	possibly damaging	Het
Ttc6	T	A	12: 57,673,100	L819Q	possibly damaging	Het
Txlnb	A	G	10: 17,843,166	T582A	probably benign	Het
Zfp788	T	C	7: 41,649,769	S558P	probably damaging	Het

Other mutations in Arap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Arap3	APN	18	37975926	missense	probably damaging	1.00
IGL01145:Arap3	APN	18	37989179	missense	probably benign
IGL01154:Arap3	APN	18	37996734	missense	probably benign	0.28
IGL01305:Arap3	APN	18	37991327	critical splice donor site	probably null
IGL01542:Arap3	APN	18	37990836	missense	probably damaging	0.98
IGL01543:Arap3	APN	18	37990836	missense	probably damaging	0.98
IGL01544:Arap3	APN	18	37990836	missense	probably damaging	0.98
IGL01545:Arap3	APN	18	37990836	missense	probably damaging	0.98
IGL01677:Arap3	APN	18	37996647	missense	probably benign
IGL01925:Arap3	APN	18	37984246	missense	probably benign	0.21
IGL01933:Arap3	APN	18	37978453	missense	possibly damaging	0.65
IGL02048:Arap3	APN	18	37996979	missense	possibly damaging	0.56
IGL02064:Arap3	APN	18	37991701	missense	probably damaging	1.00
IGL02207:Arap3	APN	18	37987853	missense	probably benign	0.00
IGL02376:Arap3	APN	18	37978453	missense	possibly damaging	0.95
IGL02531:Arap3	APN	18	37989751	missense	probably damaging	0.99
IGL02568:Arap3	APN	18	37996658	missense	probably benign	0.32
IGL02640:Arap3	APN	18	37987802	missense	possibly damaging	0.71
IGL02658:Arap3	APN	18	37990994	missense	probably benign	0.09
IGL03090:Arap3	APN	18	37989112	missense	probably benign	0.00
IGL03352:Arap3	APN	18	37981302	splice site	probably benign
ANU22:Arap3	UTSW	18	37991327	critical splice donor site	probably null
P0016:Arap3	UTSW	18	37984348	missense	probably benign	0.00
PIT4260001:Arap3	UTSW	18	37996895	missense	probably benign	0.08
R0066:Arap3	UTSW	18	37996707	missense	probably benign	0.01
R0324:Arap3	UTSW	18	37973225	missense	possibly damaging	0.93
R0562:Arap3	UTSW	18	37975540	missense	probably damaging	1.00
R1289:Arap3	UTSW	18	37981973	missense	possibly damaging	0.95
R1346:Arap3	UTSW	18	37975918	missense	probably damaging	1.00
R1419:Arap3	UTSW	18	37978432	missense	possibly damaging	0.51
R1470:Arap3	UTSW	18	37989196	critical splice acceptor site	probably null
R1470:Arap3	UTSW	18	37989196	critical splice acceptor site	probably null
R1537:Arap3	UTSW	18	37989684	critical splice donor site	probably null
R1644:Arap3	UTSW	18	37984245	missense	probably damaging	1.00
R1731:Arap3	UTSW	18	37989912	missense	probably benign	0.01
R1758:Arap3	UTSW	18	37989912	missense	probably benign	0.01
R1843:Arap3	UTSW	18	37975583	missense	probably damaging	1.00
R1907:Arap3	UTSW	18	37996671	missense	probably benign	0.28
R1954:Arap3	UTSW	18	37982002	missense	probably damaging	1.00
R2124:Arap3	UTSW	18	37973350	missense	probably damaging	0.98
R2135:Arap3	UTSW	18	37974456	missense	probably damaging	1.00
R2172:Arap3	UTSW	18	37990560	missense	probably damaging	1.00
R2418:Arap3	UTSW	18	37989944	missense	probably damaging	1.00
R2419:Arap3	UTSW	18	37989944	missense	probably damaging	1.00
R2907:Arap3	UTSW	18	37990527	missense	possibly damaging	0.88
R4425:Arap3	UTSW	18	37978600	missense	probably damaging	1.00
R4669:Arap3	UTSW	18	37996254	missense	probably benign	0.08
R4734:Arap3	UTSW	18	37996275	missense	probably benign	0.00
R4815:Arap3	UTSW	18	37973243	missense	probably benign
R5328:Arap3	UTSW	18	37991687	missense	possibly damaging	0.92
R5350:Arap3	UTSW	18	37982035	missense	probably damaging	1.00
R5466:Arap3	UTSW	18	37996736	missense	probably benign	0.00
R5482:Arap3	UTSW	18	37974674	missense	possibly damaging	0.95
R5572:Arap3	UTSW	18	37991066	missense	probably damaging	1.00
R5779:Arap3	UTSW	18	37984365	missense	probably damaging	1.00
R6053:Arap3	UTSW	18	37990771	missense	probably damaging	0.98
R6166:Arap3	UTSW	18	37974370	missense	probably damaging	1.00
R6248:Arap3	UTSW	18	37991354	missense	probably benign	0.09
R6266:Arap3	UTSW	18	37990791	missense	probably damaging	0.98
R6385:Arap3	UTSW	18	37997031	nonsense	probably null
R6694:Arap3	UTSW	18	37991537	critical splice donor site	probably null
R6856:Arap3	UTSW	18	37979863	missense	possibly damaging	0.95
R7073:Arap3	UTSW	18	37974442	nonsense	probably null
R7297:Arap3	UTSW	18	37973563	missense	possibly damaging	0.81
R7352:Arap3	UTSW	18	37973278	missense	probably benign	0.00
R7652:Arap3	UTSW	18	37978452	missense	probably damaging	0.99
R7726:Arap3	UTSW	18	37989467	missense	probably damaging	0.99
R7747:Arap3	UTSW	18	37988888	splice site	probably null
R7944:Arap3	UTSW	18	37989179	missense	probably benign
R8152:Arap3	UTSW	18	37991357	missense	possibly damaging	0.61
R8338:Arap3	UTSW	18	37973630	missense	probably damaging	0.99
R8549:Arap3	UTSW	18	37973312	missense	probably benign	0.17
X0011:Arap3	UTSW	18	37974101	critical splice donor site	probably null
X0026:Arap3	UTSW	18	37985311	critical splice donor site	probably null
X0027:Arap3	UTSW	18	37973485	splice site	probably null
X0066:Arap3	UTSW	18	37991646	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAAGGGGTCCACTCTCGTAC -3'
(R):5'- CCTGTACACTGGGGCAAATAG -3'

Sequencing Primer
(F):5'- GGTCCACTCTCGTACTCGCC -3'
(R):5'- AAAGAATTTCTTTGTGCCGTCTG -3'

Posted On

2017-10-10