Incidental Mutation 'R6144:Arap3'
ID488774
Institutional Source Beutler Lab
Gene Symbol Arap3
Ensembl Gene ENSMUSG00000024451
Gene NameArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
SynonymsDRAG1, E030006K04Rik, Centd3
MMRRC Submission 044291-MU
Accession Numbers

NCBI RefSeq: NM_139206.2, NM_001205336.1; MGI:2147274

Is this an essential gene? Possibly essential (E-score: 0.748) question?
Stock #R6144 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37972624-37997574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 37985433 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 814 (G814C)
Ref Sequence ENSEMBL: ENSMUSP00000035662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042944]
Predicted Effect probably damaging
Transcript: ENSMUST00000042944
AA Change: G814C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035662
Gene: ENSMUSG00000024451
AA Change: G814C

DomainStartEndE-ValueType
SAM 1 68 1.5e-7 SMART
low complexity region 81 98 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
PH 283 376 3.4e-16 SMART
PH 390 480 1.61e-8 SMART
ArfGap 484 606 1.44e-25 SMART
low complexity region 642 661 N/A INTRINSIC
PH 671 785 2.86e1 SMART
PH 795 901 6.87e-3 SMART
RhoGAP 913 1089 2.11e-47 SMART
Pfam:RA 1113 1206 6.2e-16 PFAM
PH 1220 1323 3.46e-8 SMART
low complexity region 1388 1407 N/A INTRINSIC
low complexity region 1457 1469 N/A INTRINSIC
low complexity region 1475 1486 N/A INTRINSIC
low complexity region 1494 1529 N/A INTRINSIC
Meta Mutation Damage Score 0.1434 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (65/68)
MGI Phenotype Strain: 5428754
Lethality: E10-E11
FUNCTION: This gene encodes a phosphoinositide binding protein containing ARF-GAP, RHO-GAP, RAS-associating, and pleckstrin homology domains. The ARF-GAP and RHO-GAP domains cooperate in mediating rearrangements in the cell cytoskeleton and cell shape. It is a specific PtdIns(3,4,5)P3/PtdIns(3,4)P2-stimulated Arf6-GAP protein. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele die around E11 exhibiting pallor, embryonic growth arrest, yolk sac and placental abnormalities, and an endothelial cell-autonomous defect in sprouting angiogenesis. Knock-in mice homozygous for a point mutation display similar angiogenesis defects. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3300002I08Rik A T 2: 150,344,644 D40E possibly damaging Het
4921517D22Rik C T 13: 59,689,533 R246H probably damaging Het
Agbl1 A G 7: 76,420,084 T203A probably benign Het
Alms1 T A 6: 85,623,074 D2096E probably damaging Het
Ankrd53 T C 6: 83,762,657 probably benign Het
Armc9 T G 1: 86,244,579 I5S probably benign Het
Catsperg1 T C 7: 29,210,695 T74A probably damaging Het
Ccpg1os C A 9: 72,979,988 C79F probably damaging Het
Cdca7l T A 12: 117,873,711 probably null Het
Cfhr2 T A 1: 139,805,415 probably benign Het
Chpt1 A G 10: 88,453,093 probably benign Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Col7a1 C T 9: 108,974,080 R2149C unknown Het
Cpa4 T C 6: 30,585,083 S289P probably damaging Het
Cpsf3 G A 12: 21,306,886 probably null Het
Creb3l1 T C 2: 91,992,005 H212R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2c29 A G 19: 39,321,609 D254G possibly damaging Het
Ddx58 T C 4: 40,229,551 I78V probably benign Het
Dennd1b A G 1: 139,081,255 H232R probably damaging Het
Dhx29 T C 13: 112,964,571 L1216P probably damaging Het
Dsg1b T C 18: 20,396,419 I307T possibly damaging Het
Ep300 A G 15: 81,601,234 S141G unknown Het
Evl A C 12: 108,653,031 K101T probably damaging Het
Exph5 G A 9: 53,373,028 G470R probably benign Het
Fam126a T C 5: 23,966,369 S352G possibly damaging Het
Flg A T 3: 93,283,208 probably benign Het
Gm45704 T A 8: 72,784,292 Het
Grm1 T C 10: 11,079,896 M215V probably benign Het
Hadha T C 5: 30,140,996 D210G probably benign Het
Hmcn1 T C 1: 150,722,424 Y1709C probably damaging Het
Hrc A T 7: 45,336,733 H436L possibly damaging Het
Ido1 T A 8: 24,585,290 T259S possibly damaging Het
Itgb7 C A 15: 102,223,482 R222L probably benign Het
Khnyn T C 14: 55,887,839 V485A probably damaging Het
Kifc5b T C 17: 26,921,852 V100A probably benign Het
Lsm10 T C 4: 126,098,001 M50T probably damaging Het
Map3k6 T G 4: 133,245,675 W382G probably damaging Het
Mink1 T A 11: 70,610,652 F922I possibly damaging Het
Mpp5 T C 12: 78,824,789 V381A possibly damaging Het
Mrap2 T C 9: 87,175,818 V53A probably damaging Het
Mrps7 C A 11: 115,604,174 A5E probably benign Het
Muc4 A G 16: 32,766,924 N2713S possibly damaging Het
Nckipsd T C 9: 108,812,386 S249P probably damaging Het
Neil3 T C 8: 53,599,412 T384A probably benign Het
Noc3l A T 19: 38,798,955 I504K probably damaging Het
Nudt13 A G 14: 20,307,771 N107S probably benign Het
Olfr134 T A 17: 38,175,225 L47H probably damaging Het
Olfr368 T A 2: 37,332,113 M122K probably damaging Het
Olfr747 C A 14: 50,680,935 R233L probably benign Het
Otub1 G T 19: 7,199,153 Y205* probably null Het
Plpp7 T A 2: 32,096,088 S93T probably damaging Het
Pxk T G 14: 8,138,011 Y188D probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpap1 A T 2: 119,772,647 C602* probably null Het
Sbds T C 5: 130,246,344 K248E probably benign Het
Serpina10 A T 12: 103,628,833 N42K probably benign Het
Slc7a8 A G 14: 54,729,340 L368P probably damaging Het
Srrm1 T C 4: 135,337,873 probably benign Het
Sun2 C T 15: 79,730,332 V288I probably benign Het
Tas2r107 C A 6: 131,660,003 A28S possibly damaging Het
Tbc1d9b T C 11: 50,146,328 I268T probably benign Het
Tjp2 A G 19: 24,120,073 F495L probably damaging Het
Top2b T C 14: 16,423,740 L1434P possibly damaging Het
Top3b A G 16: 16,879,141 probably null Het
Trdv2-2 A T 14: 53,961,304 E17V possibly damaging Het
Ttc6 T A 12: 57,673,100 L819Q possibly damaging Het
Txlnb A G 10: 17,843,166 T582A probably benign Het
Zfp788 T C 7: 41,649,769 S558P probably damaging Het
Other mutations in Arap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Arap3 APN 18 37975926 missense probably damaging 1.00
IGL01145:Arap3 APN 18 37989179 missense probably benign
IGL01154:Arap3 APN 18 37996734 missense probably benign 0.28
IGL01305:Arap3 APN 18 37991327 critical splice donor site probably null
IGL01542:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01543:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01544:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01545:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01677:Arap3 APN 18 37996647 missense probably benign
IGL01925:Arap3 APN 18 37984246 missense probably benign 0.21
IGL01933:Arap3 APN 18 37978453 missense possibly damaging 0.65
IGL02048:Arap3 APN 18 37996979 missense possibly damaging 0.56
IGL02064:Arap3 APN 18 37991701 missense probably damaging 1.00
IGL02207:Arap3 APN 18 37987853 missense probably benign 0.00
IGL02376:Arap3 APN 18 37978453 missense possibly damaging 0.95
IGL02531:Arap3 APN 18 37989751 missense probably damaging 0.99
IGL02568:Arap3 APN 18 37996658 missense probably benign 0.32
IGL02640:Arap3 APN 18 37987802 missense possibly damaging 0.71
IGL02658:Arap3 APN 18 37990994 missense probably benign 0.09
IGL03090:Arap3 APN 18 37989112 missense probably benign 0.00
IGL03352:Arap3 APN 18 37981302 splice site probably benign
ANU22:Arap3 UTSW 18 37991327 critical splice donor site probably null
P0016:Arap3 UTSW 18 37984348 missense probably benign 0.00
PIT4260001:Arap3 UTSW 18 37996895 missense probably benign 0.08
R0066:Arap3 UTSW 18 37996707 missense probably benign 0.01
R0324:Arap3 UTSW 18 37973225 missense possibly damaging 0.93
R0562:Arap3 UTSW 18 37975540 missense probably damaging 1.00
R1289:Arap3 UTSW 18 37981973 missense possibly damaging 0.95
R1346:Arap3 UTSW 18 37975918 missense probably damaging 1.00
R1419:Arap3 UTSW 18 37978432 missense possibly damaging 0.51
R1470:Arap3 UTSW 18 37989196 critical splice acceptor site probably null
R1470:Arap3 UTSW 18 37989196 critical splice acceptor site probably null
R1537:Arap3 UTSW 18 37989684 critical splice donor site probably null
R1644:Arap3 UTSW 18 37984245 missense probably damaging 1.00
R1731:Arap3 UTSW 18 37989912 missense probably benign 0.01
R1758:Arap3 UTSW 18 37989912 missense probably benign 0.01
R1843:Arap3 UTSW 18 37975583 missense probably damaging 1.00
R1907:Arap3 UTSW 18 37996671 missense probably benign 0.28
R1954:Arap3 UTSW 18 37982002 missense probably damaging 1.00
R2124:Arap3 UTSW 18 37973350 missense probably damaging 0.98
R2135:Arap3 UTSW 18 37974456 missense probably damaging 1.00
R2172:Arap3 UTSW 18 37990560 missense probably damaging 1.00
R2418:Arap3 UTSW 18 37989944 missense probably damaging 1.00
R2419:Arap3 UTSW 18 37989944 missense probably damaging 1.00
R2907:Arap3 UTSW 18 37990527 missense possibly damaging 0.88
R4425:Arap3 UTSW 18 37978600 missense probably damaging 1.00
R4669:Arap3 UTSW 18 37996254 missense probably benign 0.08
R4734:Arap3 UTSW 18 37996275 missense probably benign 0.00
R4815:Arap3 UTSW 18 37973243 missense probably benign
R5328:Arap3 UTSW 18 37991687 missense possibly damaging 0.92
R5350:Arap3 UTSW 18 37982035 missense probably damaging 1.00
R5466:Arap3 UTSW 18 37996736 missense probably benign 0.00
R5482:Arap3 UTSW 18 37974674 missense possibly damaging 0.95
R5572:Arap3 UTSW 18 37991066 missense probably damaging 1.00
R5779:Arap3 UTSW 18 37984365 missense probably damaging 1.00
R6053:Arap3 UTSW 18 37990771 missense probably damaging 0.98
R6166:Arap3 UTSW 18 37974370 missense probably damaging 1.00
R6248:Arap3 UTSW 18 37991354 missense probably benign 0.09
R6266:Arap3 UTSW 18 37990791 missense probably damaging 0.98
R6385:Arap3 UTSW 18 37997031 nonsense probably null
R6694:Arap3 UTSW 18 37991537 critical splice donor site probably null
R6856:Arap3 UTSW 18 37979863 missense possibly damaging 0.95
R7073:Arap3 UTSW 18 37974442 nonsense probably null
R7297:Arap3 UTSW 18 37973563 missense possibly damaging 0.81
R7352:Arap3 UTSW 18 37973278 missense probably benign 0.00
R7652:Arap3 UTSW 18 37978452 missense probably damaging 0.99
R7726:Arap3 UTSW 18 37989467 missense probably damaging 0.99
R7747:Arap3 UTSW 18 37988888 splice site probably null
R7944:Arap3 UTSW 18 37989179 missense probably benign
R8152:Arap3 UTSW 18 37991357 missense possibly damaging 0.61
R8338:Arap3 UTSW 18 37973630 missense probably damaging 0.99
R8549:Arap3 UTSW 18 37973312 missense probably benign 0.17
X0011:Arap3 UTSW 18 37974101 critical splice donor site probably null
X0026:Arap3 UTSW 18 37985311 critical splice donor site probably null
X0027:Arap3 UTSW 18 37973485 splice site probably null
X0066:Arap3 UTSW 18 37991646 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGGGGTCCACTCTCGTAC -3'
(R):5'- CCTGTACACTGGGGCAAATAG -3'

Sequencing Primer
(F):5'- GGTCCACTCTCGTACTCGCC -3'
(R):5'- AAAGAATTTCTTTGTGCCGTCTG -3'
Posted On2017-10-10