Incidental Mutation 'R6144:Cyp2c29'
ID488778
Institutional Source Beutler Lab
Gene Symbol Cyp2c29
Ensembl Gene ENSMUSG00000003053
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 29
SynonymsAh-2, Cyp2c, P450-2C, Ahh-1, AHOHase, AHOH
MMRRC Submission 044291-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6144 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location39269405-39330713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39321609 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 254 (D254G)
Ref Sequence ENSEMBL: ENSMUSP00000135863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003137] [ENSMUST00000176624] [ENSMUST00000177087]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003137
AA Change: D293G

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003137
Gene: ENSMUSG00000003053
AA Change: D293G

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:p450 30 487 5.4e-165 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176624
AA Change: D254G

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135863
Gene: ENSMUSG00000003053
AA Change: D254G

DomainStartEndE-ValueType
Pfam:p450 12 448 2.7e-156 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177087
SMART Domains Protein: ENSMUSP00000135839
Gene: ENSMUSG00000003053

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:p450 30 118 8.4e-22 PFAM
Meta Mutation Damage Score 0.6396 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (65/68)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3300002I08Rik A T 2: 150,344,644 D40E possibly damaging Het
4921517D22Rik C T 13: 59,689,533 R246H probably damaging Het
Agbl1 A G 7: 76,420,084 T203A probably benign Het
Alms1 T A 6: 85,623,074 D2096E probably damaging Het
Ankrd53 T C 6: 83,762,657 probably benign Het
Arap3 C A 18: 37,985,433 G814C probably damaging Het
Armc9 T G 1: 86,244,579 I5S probably benign Het
Catsperg1 T C 7: 29,210,695 T74A probably damaging Het
Ccpg1os C A 9: 72,979,988 C79F probably damaging Het
Cdca7l T A 12: 117,873,711 probably null Het
Cfhr2 T A 1: 139,805,415 probably benign Het
Chpt1 A G 10: 88,453,093 probably benign Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Col7a1 C T 9: 108,974,080 R2149C unknown Het
Cpa4 T C 6: 30,585,083 S289P probably damaging Het
Cpsf3 G A 12: 21,306,886 probably null Het
Creb3l1 T C 2: 91,992,005 H212R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Ddx58 T C 4: 40,229,551 I78V probably benign Het
Dennd1b A G 1: 139,081,255 H232R probably damaging Het
Dhx29 T C 13: 112,964,571 L1216P probably damaging Het
Dsg1b T C 18: 20,396,419 I307T possibly damaging Het
Ep300 A G 15: 81,601,234 S141G unknown Het
Evl A C 12: 108,653,031 K101T probably damaging Het
Exph5 G A 9: 53,373,028 G470R probably benign Het
Fam126a T C 5: 23,966,369 S352G possibly damaging Het
Flg A T 3: 93,283,208 probably benign Het
Gm45704 T A 8: 72,784,292 Het
Grm1 T C 10: 11,079,896 M215V probably benign Het
Hadha T C 5: 30,140,996 D210G probably benign Het
Hmcn1 T C 1: 150,722,424 Y1709C probably damaging Het
Hrc A T 7: 45,336,733 H436L possibly damaging Het
Ido1 T A 8: 24,585,290 T259S possibly damaging Het
Itgb7 C A 15: 102,223,482 R222L probably benign Het
Khnyn T C 14: 55,887,839 V485A probably damaging Het
Kifc5b T C 17: 26,921,852 V100A probably benign Het
Lsm10 T C 4: 126,098,001 M50T probably damaging Het
Map3k6 T G 4: 133,245,675 W382G probably damaging Het
Mink1 T A 11: 70,610,652 F922I possibly damaging Het
Mpp5 T C 12: 78,824,789 V381A possibly damaging Het
Mrap2 T C 9: 87,175,818 V53A probably damaging Het
Mrps7 C A 11: 115,604,174 A5E probably benign Het
Muc4 A G 16: 32,766,924 N2713S possibly damaging Het
Nckipsd T C 9: 108,812,386 S249P probably damaging Het
Neil3 T C 8: 53,599,412 T384A probably benign Het
Noc3l A T 19: 38,798,955 I504K probably damaging Het
Nudt13 A G 14: 20,307,771 N107S probably benign Het
Olfr134 T A 17: 38,175,225 L47H probably damaging Het
Olfr368 T A 2: 37,332,113 M122K probably damaging Het
Olfr747 C A 14: 50,680,935 R233L probably benign Het
Otub1 G T 19: 7,199,153 Y205* probably null Het
Plpp7 T A 2: 32,096,088 S93T probably damaging Het
Pxk T G 14: 8,138,011 Y188D probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpap1 A T 2: 119,772,647 C602* probably null Het
Sbds T C 5: 130,246,344 K248E probably benign Het
Serpina10 A T 12: 103,628,833 N42K probably benign Het
Slc7a8 A G 14: 54,729,340 L368P probably damaging Het
Srrm1 T C 4: 135,337,873 probably benign Het
Sun2 C T 15: 79,730,332 V288I probably benign Het
Tas2r107 C A 6: 131,660,003 A28S possibly damaging Het
Tbc1d9b T C 11: 50,146,328 I268T probably benign Het
Tjp2 A G 19: 24,120,073 F495L probably damaging Het
Top2b T C 14: 16,423,740 L1434P possibly damaging Het
Top3b A G 16: 16,879,141 probably null Het
Trdv2-2 A T 14: 53,961,304 E17V possibly damaging Het
Ttc6 T A 12: 57,673,100 L819Q possibly damaging Het
Txlnb A G 10: 17,843,166 T582A probably benign Het
Zfp788 T C 7: 41,649,769 S558P probably damaging Het
Other mutations in Cyp2c29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cyp2c29 APN 19 39321699 splice site probably benign
IGL00482:Cyp2c29 APN 19 39325023 missense probably damaging 0.97
IGL00694:Cyp2c29 APN 19 39321635 missense possibly damaging 0.64
IGL00836:Cyp2c29 APN 19 39324990 missense probably damaging 0.98
IGL00858:Cyp2c29 APN 19 39307656 missense probably damaging 1.00
IGL01350:Cyp2c29 APN 19 39330327 missense probably damaging 1.00
IGL01455:Cyp2c29 APN 19 39329117 missense possibly damaging 0.89
IGL01718:Cyp2c29 APN 19 39330260 missense possibly damaging 0.48
IGL01977:Cyp2c29 APN 19 39290897 splice site probably benign
IGL01991:Cyp2c29 APN 19 39330315 missense probably damaging 1.00
IGL02097:Cyp2c29 APN 19 39307620 missense probably damaging 1.00
IGL02267:Cyp2c29 APN 19 39330422 missense probably benign 0.19
IGL02451:Cyp2c29 APN 19 39290847 missense possibly damaging 0.66
IGL02452:Cyp2c29 APN 19 39290847 missense possibly damaging 0.66
IGL02548:Cyp2c29 APN 19 39290847 missense possibly damaging 0.66
IGL02549:Cyp2c29 APN 19 39309785 missense possibly damaging 0.48
IGL02938:Cyp2c29 APN 19 39287123 missense probably damaging 0.99
IGL03252:Cyp2c29 APN 19 39287175 missense probably damaging 1.00
IGL03367:Cyp2c29 APN 19 39329215 missense probably damaging 0.97
H8562:Cyp2c29 UTSW 19 39309662 missense probably damaging 1.00
IGL03052:Cyp2c29 UTSW 19 39287218 missense possibly damaging 0.90
R0415:Cyp2c29 UTSW 19 39329095 splice site probably benign
R0504:Cyp2c29 UTSW 19 39309780 missense probably benign 0.29
R0690:Cyp2c29 UTSW 19 39309726 missense probably benign 0.00
R1531:Cyp2c29 UTSW 19 39324968 missense probably damaging 1.00
R1730:Cyp2c29 UTSW 19 39324945 missense possibly damaging 0.79
R1981:Cyp2c29 UTSW 19 39307772 splice site probably null
R2113:Cyp2c29 UTSW 19 39330264 missense probably damaging 1.00
R2220:Cyp2c29 UTSW 19 39287232 missense probably benign 0.09
R3873:Cyp2c29 UTSW 19 39329144 missense probably damaging 0.99
R4424:Cyp2c29 UTSW 19 39287176 missense probably damaging 0.98
R4451:Cyp2c29 UTSW 19 39290826 missense probably damaging 0.99
R4803:Cyp2c29 UTSW 19 39324995 missense probably benign 0.01
R5288:Cyp2c29 UTSW 19 39330372 missense probably damaging 0.96
R5474:Cyp2c29 UTSW 19 39324992 missense probably damaging 1.00
R5475:Cyp2c29 UTSW 19 39330287 missense possibly damaging 0.91
R5893:Cyp2c29 UTSW 19 39330389 missense possibly damaging 0.93
R5894:Cyp2c29 UTSW 19 39330389 missense possibly damaging 0.93
R6000:Cyp2c29 UTSW 19 39307606 critical splice acceptor site probably null
R6296:Cyp2c29 UTSW 19 39330261 missense possibly damaging 0.64
R6365:Cyp2c29 UTSW 19 39307754 missense probably damaging 1.00
R6449:Cyp2c29 UTSW 19 39290867 missense probably benign 0.05
R6464:Cyp2c29 UTSW 19 39329225 missense probably damaging 0.96
R6919:Cyp2c29 UTSW 19 39291141 missense probably benign 0.26
R6978:Cyp2c29 UTSW 19 39321663 missense probably damaging 1.00
R7038:Cyp2c29 UTSW 19 39287127 missense probably benign 0.01
R7040:Cyp2c29 UTSW 19 39330337 missense possibly damaging 0.95
R7391:Cyp2c29 UTSW 19 39307767 missense probably null 0.98
X0024:Cyp2c29 UTSW 19 39321599 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAAATGGAAGCTATGTAGTTTCTCC -3'
(R):5'- GTTCATTACAGTCAGTAGCAGAGAAG -3'

Sequencing Primer
(F):5'- CACAACTGTAGATTCACTGTA -3'
(R):5'- AGGTGAAGGTCTGAGACTGTTTTAAG -3'
Posted On2017-10-10