Incidental Mutation 'R6144:Cybb'
ID488779
Institutional Source Beutler Lab
Gene Symbol Cybb
Ensembl Gene ENSMUSG00000015340
Gene Namecytochrome b-245, beta polypeptide
Synonymsgp91phox, gp91, Cgd, Nox2
MMRRC Submission 044291-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6144 (G1)
Quality Score221.999
Status Validated
ChromosomeX
Chromosomal Location9435252-9487771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 9450750 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Histidine at position 246 (D246H)
Ref Sequence ENSEMBL: ENSMUSP00000015484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015484] [ENSMUST00000164685]
Predicted Effect probably benign
Transcript: ENSMUST00000015484
AA Change: D246H

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000015484
Gene: ENSMUSG00000015340
AA Change: D246H

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:Ferric_reduct 54 220 8.4e-29 PFAM
Pfam:FAD_binding_6 292 395 1.6e-7 PFAM
Pfam:FAD_binding_8 292 395 1e-24 PFAM
Pfam:NAD_binding_6 401 551 5.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154503
Predicted Effect probably benign
Transcript: ENSMUST00000164685
SMART Domains Protein: ENSMUSP00000128963
Gene: ENSMUSG00000015340

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: This gene encodes the heavy chain component of a heterodimeric transmembrane ion transporter composed of both a heavy and a light chain. This transporter mediates the transfer of electrons from nicotinamide adenine dinucleotide phosphate (NADPH) to oxygen to generate superoxide. This reaction is important in the innate immune response to pathogens. However, increased activity of the encoded protein also leads to the generation of reactive oxygen species that result in oxidative stress and can cause tissue damage. Conversely, loss of function of the related gene in human causes chronic granulomatous disease. Alternative splicing results in multiple transcript variants, although the full-length nature of some of these variants has not been determined. [provided by RefSeq, May 2013]
PHENOTYPE: Nullizygous mice show alterations in acute inflammation, synaptic plasticity, memory, metastatic potential, susceptibility to infection and induced GI injury, inflammatory response to chemical peritonitis, vascular response to Ang II, hypoxia-induced LV remodeling, and L-NAME-caused renal responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3300002I08Rik A T 2: 150,344,644 D40E possibly damaging Het
4921517D22Rik C T 13: 59,689,533 R246H probably damaging Het
Agbl1 A G 7: 76,420,084 T203A probably benign Het
Alms1 T A 6: 85,623,074 D2096E probably damaging Het
Ankrd53 T C 6: 83,762,657 probably benign Het
Arap3 C A 18: 37,985,433 G814C probably damaging Het
Armc9 T G 1: 86,244,579 I5S probably benign Het
Catsperg1 T C 7: 29,210,695 T74A probably damaging Het
Ccpg1os C A 9: 72,979,988 C79F probably damaging Het
Cdca7l T A 12: 117,873,711 probably null Het
Cfhr2 T A 1: 139,805,415 probably benign Het
Chpt1 A G 10: 88,453,093 probably benign Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Col7a1 C T 9: 108,974,080 R2149C unknown Het
Cpa4 T C 6: 30,585,083 S289P probably damaging Het
Cpsf3 G A 12: 21,306,886 probably null Het
Creb3l1 T C 2: 91,992,005 H212R possibly damaging Het
Cyp2c29 A G 19: 39,321,609 D254G possibly damaging Het
Ddx58 T C 4: 40,229,551 I78V probably benign Het
Dennd1b A G 1: 139,081,255 H232R probably damaging Het
Dhx29 T C 13: 112,964,571 L1216P probably damaging Het
Dsg1b T C 18: 20,396,419 I307T possibly damaging Het
Ep300 A G 15: 81,601,234 S141G unknown Het
Evl A C 12: 108,653,031 K101T probably damaging Het
Exph5 G A 9: 53,373,028 G470R probably benign Het
Fam126a T C 5: 23,966,369 S352G possibly damaging Het
Flg A T 3: 93,283,208 probably benign Het
Gm45704 T A 8: 72,784,292 Het
Grm1 T C 10: 11,079,896 M215V probably benign Het
Hadha T C 5: 30,140,996 D210G probably benign Het
Hmcn1 T C 1: 150,722,424 Y1709C probably damaging Het
Hrc A T 7: 45,336,733 H436L possibly damaging Het
Ido1 T A 8: 24,585,290 T259S possibly damaging Het
Itgb7 C A 15: 102,223,482 R222L probably benign Het
Khnyn T C 14: 55,887,839 V485A probably damaging Het
Kifc5b T C 17: 26,921,852 V100A probably benign Het
Lsm10 T C 4: 126,098,001 M50T probably damaging Het
Map3k6 T G 4: 133,245,675 W382G probably damaging Het
Mink1 T A 11: 70,610,652 F922I possibly damaging Het
Mpp5 T C 12: 78,824,789 V381A possibly damaging Het
Mrap2 T C 9: 87,175,818 V53A probably damaging Het
Mrps7 C A 11: 115,604,174 A5E probably benign Het
Muc4 A G 16: 32,766,924 N2713S possibly damaging Het
Nckipsd T C 9: 108,812,386 S249P probably damaging Het
Neil3 T C 8: 53,599,412 T384A probably benign Het
Noc3l A T 19: 38,798,955 I504K probably damaging Het
Nudt13 A G 14: 20,307,771 N107S probably benign Het
Olfr134 T A 17: 38,175,225 L47H probably damaging Het
Olfr368 T A 2: 37,332,113 M122K probably damaging Het
Olfr747 C A 14: 50,680,935 R233L probably benign Het
Otub1 G T 19: 7,199,153 Y205* probably null Het
Plpp7 T A 2: 32,096,088 S93T probably damaging Het
Pxk T G 14: 8,138,011 Y188D probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpap1 A T 2: 119,772,647 C602* probably null Het
Sbds T C 5: 130,246,344 K248E probably benign Het
Serpina10 A T 12: 103,628,833 N42K probably benign Het
Slc7a8 A G 14: 54,729,340 L368P probably damaging Het
Srrm1 T C 4: 135,337,873 probably benign Het
Sun2 C T 15: 79,730,332 V288I probably benign Het
Tas2r107 C A 6: 131,660,003 A28S possibly damaging Het
Tbc1d9b T C 11: 50,146,328 I268T probably benign Het
Tjp2 A G 19: 24,120,073 F495L probably damaging Het
Top2b T C 14: 16,423,740 L1434P possibly damaging Het
Top3b A G 16: 16,879,141 probably null Het
Trdv2-2 A T 14: 53,961,304 E17V possibly damaging Het
Ttc6 T A 12: 57,673,100 L819Q possibly damaging Het
Txlnb A G 10: 17,843,166 T582A probably benign Het
Zfp788 T C 7: 41,649,769 S558P probably damaging Het
Other mutations in Cybb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Cybb APN X 9446744 missense possibly damaging 0.46
IGL02145:Cybb APN X 9457018 missense probably damaging 1.00
IGL02626:Cybb APN X 9469200 splice site probably null
IGL02644:Cybb APN X 9467156 missense probably benign 0.00
IGL02869:Cybb APN X 9442589 missense probably benign 0.00
IGL03145:Cybb APN X 9453653 nonsense probably null
R3978:Cybb UTSW X 9444588 missense probably damaging 1.00
R3980:Cybb UTSW X 9444588 missense probably damaging 1.00
R4758:Cybb UTSW X 9450750 missense probably benign 0.10
R4761:Cybb UTSW X 9450750 missense probably benign 0.10
R4787:Cybb UTSW X 9450750 missense probably benign 0.10
R4788:Cybb UTSW X 9450750 missense probably benign 0.10
R4793:Cybb UTSW X 9450750 missense probably benign 0.10
R4847:Cybb UTSW X 9450750 missense probably benign 0.10
R4901:Cybb UTSW X 9450750 missense probably benign 0.10
R4902:Cybb UTSW X 9450750 missense probably benign 0.10
R4904:Cybb UTSW X 9450750 missense probably benign 0.10
R4914:Cybb UTSW X 9450750 missense probably benign 0.10
R4915:Cybb UTSW X 9450750 missense probably benign 0.10
R4916:Cybb UTSW X 9450750 missense probably benign 0.10
R5058:Cybb UTSW X 9450750 missense probably benign 0.10
R5246:Cybb UTSW X 9450750 missense probably benign 0.10
R5416:Cybb UTSW X 9450750 missense probably benign 0.10
R5519:Cybb UTSW X 9450750 missense probably benign 0.10
R5538:Cybb UTSW X 9450750 missense probably benign 0.10
R5539:Cybb UTSW X 9450750 missense probably benign 0.10
R5576:Cybb UTSW X 9450750 missense probably benign 0.10
R5578:Cybb UTSW X 9450750 missense probably benign 0.10
R5728:Cybb UTSW X 9450750 missense probably benign 0.10
R5729:Cybb UTSW X 9450750 missense probably benign 0.10
R5761:Cybb UTSW X 9450750 missense probably benign 0.10
R5762:Cybb UTSW X 9450750 missense probably benign 0.10
R5927:Cybb UTSW X 9450750 missense probably benign 0.10
R6057:Cybb UTSW X 9450750 missense probably benign 0.10
R6086:Cybb UTSW X 9450750 missense probably benign 0.10
R6147:Cybb UTSW X 9450750 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ATGTTTCCCACATGTCCTGG -3'
(R):5'- TTTGCGATATGTGCACAATCAG -3'

Sequencing Primer
(F):5'- CTTCTCAACTTGACACATGCTAGAG -3'
(R):5'- CACAATCAGTGTTGAGGATATAGGCC -3'
Posted On2017-10-10