Incidental Mutation 'R6145:Nfasc'
ID488783
Institutional Source Beutler Lab
Gene Symbol Nfasc
Ensembl Gene ENSMUSG00000026442
Gene Nameneurofascin
SynonymsD430023G06Rik
MMRRC Submission 044292-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6145 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location132564690-132741797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 132634717 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 107 (G107R)
Ref Sequence ENSEMBL: ENSMUSP00000139955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043189] [ENSMUST00000094569] [ENSMUST00000163770] [ENSMUST00000187861] [ENSMUST00000188307]
Predicted Effect probably damaging
Transcript: ENSMUST00000043189
AA Change: G101R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035454
Gene: ENSMUSG00000026442
AA Change: G101R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 4.5e0 SMART
IG 141 228 2.44e-7 SMART
IGc2 253 317 1.53e-17 SMART
IGc2 343 409 1.76e-8 SMART
IGc2 437 502 2.39e-10 SMART
IGc2 528 593 2.54e-5 SMART
FN3 607 690 2.17e-11 SMART
FN3 707 789 2.85e-6 SMART
FN3 805 896 2.21e-3 SMART
FN3 911 995 9.92e-6 SMART
low complexity region 996 1018 N/A INTRINSIC
transmembrane domain 1026 1048 N/A INTRINSIC
Pfam:Bravo_FIGEY 1049 1133 1.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094569
AA Change: G107R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092148
Gene: ENSMUSG00000026442
AA Change: G107R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 48 137 4.5e0 SMART
IG 147 234 2.44e-7 SMART
IGc2 259 323 1.53e-17 SMART
IGc2 349 415 1.76e-8 SMART
IGc2 443 508 2.39e-10 SMART
IGc2 534 599 2.54e-5 SMART
FN3 628 711 2.17e-11 SMART
FN3 728 810 2.85e-6 SMART
FN3 825 909 9.92e-6 SMART
FN3 1010 1086 6.91e-5 SMART
transmembrane domain 1109 1131 N/A INTRINSIC
Pfam:Bravo_FIGEY 1132 1216 2.2e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163770
AA Change: G101R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132979
Gene: ENSMUSG00000026442
AA Change: G101R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 4.5e0 SMART
IG 141 228 2.44e-7 SMART
IGc2 270 334 1.53e-17 SMART
IGc2 360 426 1.76e-8 SMART
IGc2 454 519 2.39e-10 SMART
IGc2 545 610 2.54e-5 SMART
FN3 624 707 2.17e-11 SMART
FN3 724 806 2.85e-6 SMART
FN3 822 913 2.21e-3 SMART
FN3 928 1012 9.92e-6 SMART
low complexity region 1013 1035 N/A INTRINSIC
transmembrane domain 1043 1065 N/A INTRINSIC
Pfam:Bravo_FIGEY 1066 1150 5e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186389
AA Change: G70R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000187861
AA Change: G107R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139955
Gene: ENSMUSG00000026442
AA Change: G107R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 48 137 1.8e-2 SMART
IG 147 234 1e-9 SMART
IGc2 259 323 6.4e-20 SMART
IGc2 349 415 7e-11 SMART
IGc2 443 508 9.7e-13 SMART
IGc2 534 599 1.1e-7 SMART
FN3 628 711 1e-13 SMART
FN3 728 810 1.4e-8 SMART
FN3 826 917 1.1e-5 SMART
FN3 932 1016 4.8e-8 SMART
FN3 1117 1193 3.4e-7 SMART
transmembrane domain 1216 1238 N/A INTRINSIC
Pfam:Bravo_FIGEY 1239 1325 2.6e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188307
AA Change: G101R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139520
Gene: ENSMUSG00000026442
AA Change: G101R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 1.8e-2 SMART
IG 141 228 1e-9 SMART
IGc2 253 317 6.4e-20 SMART
IGc2 343 409 7e-11 SMART
IGc2 437 502 9.7e-13 SMART
IGc2 528 593 1.1e-7 SMART
FN3 622 705 1e-13 SMART
FN3 722 804 1.4e-8 SMART
FN3 820 890 3.8e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an L1 family immunoglobulin cell adhesion molecule with multiple IGcam and fibronectin domains. The protein functions in neurite outgrowth, neurite fasciculation, and organization of the axon initial segment (AIS) and nodes of Ranvier on axons during early development. Both the AIS and nodes of Ranvier contain high densities of voltage-gated Na+ (Nav) channels which are clustered by interactions with cytoskeletal and scaffolding proteins including this protein, gliomedin, ankyrin 3 (ankyrin-G), and betaIV spectrin. This protein links the AIS extracellular matrix to the intracellular cytoskeleton. This gene undergoes extensive alternative splicing, and the full-length nature of some variants has not been determined. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele die within 6 to 7 days of birth, exhibit reduced nerve conduction velocity and abnormal paranodal junction formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 86,052,942 probably null Het
4930402H24Rik T C 2: 130,778,473 I247V probably benign Het
Abca8b A G 11: 109,973,808 V316A probably benign Het
Acad10 A T 5: 121,622,033 V999D probably damaging Het
Acot8 A G 2: 164,803,065 V66A probably benign Het
Ankrd11 T C 8: 122,892,661 H1484R probably damaging Het
Anxa6 A G 11: 54,994,904 F405S probably damaging Het
Asmt G A X: 170,674,663 V101I probably damaging Het
Atp1a2 C T 1: 172,287,238 V327I probably damaging Het
Brdt A G 5: 107,377,999 E906G possibly damaging Het
Cacna1g A T 11: 94,462,261 C313S probably damaging Het
Camk2d T C 3: 126,805,858 I329T probably benign Het
Cavin4 A T 4: 48,663,794 H58L probably damaging Het
Ccdc78 C A 17: 25,789,065 P317T probably benign Het
Cdc16 T G 8: 13,767,573 Y295D possibly damaging Het
Cdyl2 T A 8: 116,594,978 N270I probably damaging Het
Cfap221 T A 1: 119,984,816 I114F possibly damaging Het
Dmxl1 A G 18: 49,912,766 E2414G possibly damaging Het
Dnah1 C A 14: 31,300,970 R1070L probably benign Het
Dnah14 T C 1: 181,666,417 S1713P probably benign Het
Dock10 C A 1: 80,575,904 G602* probably null Het
Ep400 A T 5: 110,756,703 V10D possibly damaging Het
Epas1 T C 17: 86,829,429 C807R probably benign Het
Esrrb C T 12: 86,505,899 P200L probably benign Het
Fbxw26 T C 9: 109,732,623 I168V probably benign Het
Fsip2 A T 2: 82,993,768 H6615L possibly damaging Het
Galk2 A T 2: 125,946,842 Q272L possibly damaging Het
Gas7 A C 11: 67,629,612 T43P probably damaging Het
Gm5134 A T 10: 75,995,839 I371F probably damaging Het
Gpr31b C T 17: 13,051,379 R301Q possibly damaging Het
Grk1 T A 8: 13,405,765 Y216* probably null Het
Grm5 T A 7: 88,026,601 M441K probably damaging Het
Heatr6 A G 11: 83,766,136 E408G probably damaging Het
Hoxc9 G T 15: 102,983,959 K201N probably damaging Het
Igsf10 T A 3: 59,331,656 Y368F possibly damaging Het
Il2ra A T 2: 11,680,246 D131V probably damaging Het
Imp4 A G 1: 34,440,096 E19G probably benign Het
Kcnk18 T C 19: 59,235,607 *395Q probably null Het
Kdm6b A T 11: 69,405,026 L805Q unknown Het
Lgr4 T A 2: 110,007,243 L427* probably null Het
Myt1l G A 12: 29,832,381 S525N unknown Het
Nasp G A 4: 116,611,077 T237I probably benign Het
Nell2 G T 15: 95,473,561 Q98K probably damaging Het
Nsun4 A G 4: 116,040,206 S203P probably damaging Het
Olfr24 T G 9: 18,755,569 D22A probably benign Het
Olfr855 T C 9: 19,584,888 V117A probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pde10a T C 17: 8,929,117 V366A probably damaging Het
Pdxk T A 10: 78,443,791 D250V probably benign Het
Pih1d1 T A 7: 45,159,044 I179N probably damaging Het
Plaa T A 4: 94,583,992 I294F probably damaging Het
Pmel C A 10: 128,715,935 P213T probably damaging Het
Pom121l2 A T 13: 21,982,302 R248* probably null Het
Pou2f1 T C 1: 165,875,433 probably benign Het
Ppm1j G A 3: 104,781,379 R98H probably damaging Het
Prkdc C T 16: 15,772,073 P2600L probably damaging Het
Prom1 T C 5: 44,029,649 N422S probably benign Het
Pspn C T 17: 56,999,467 C154Y probably damaging Het
Ptdss1 T C 13: 66,972,637 probably null Het
Rapgef1 A G 2: 29,736,666 Y993C probably damaging Het
Scrn2 A C 11: 97,032,853 T219P probably benign Het
Sec23ip T G 7: 128,778,484 S874R probably damaging Het
Sept4 G A 11: 87,585,246 probably null Het
Slc15a3 C T 19: 10,857,251 L499F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sra1 A G 18: 36,667,575 M193T probably damaging Het
Srsf4 G T 4: 131,900,294 probably benign Het
Syne1 T C 10: 5,052,750 D8055G probably damaging Het
Syne4 T A 7: 30,316,563 probably null Het
Tbc1d24 C A 17: 24,208,229 G253V probably damaging Het
Tbck T A 3: 132,732,215 I467N probably damaging Het
Tln1 T A 4: 43,538,030 M1857L possibly damaging Het
Ttll2 T C 17: 7,351,632 R299G probably benign Het
Ugt2b36 T G 5: 87,066,213 E524A probably benign Het
Vmn2r124 C T 17: 18,062,851 T269I probably benign Het
Vmn2r4 A G 3: 64,406,943 F206L probably benign Het
Zfp346 A G 13: 55,115,574 K156R probably damaging Het
Other mutations in Nfasc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Nfasc APN 1 132573798 nonsense probably null
IGL01088:Nfasc APN 1 132642776 utr 5 prime probably benign
IGL01958:Nfasc APN 1 132608438 nonsense probably null
IGL01999:Nfasc APN 1 132605247 splice site probably benign
IGL02170:Nfasc APN 1 132610366 nonsense probably null
IGL02187:Nfasc APN 1 132570481 missense probably damaging 1.00
IGL02192:Nfasc APN 1 132570481 missense probably damaging 1.00
IGL02452:Nfasc APN 1 132620924 critical splice donor site probably null
IGL02698:Nfasc APN 1 132634737 missense probably benign 0.06
IGL02797:Nfasc APN 1 132610448 missense probably damaging 1.00
IGL03000:Nfasc APN 1 132621509 splice site probably benign
IGL03027:Nfasc APN 1 132610469 missense probably damaging 1.00
jiggle UTSW 1 132602021 missense probably damaging 1.00
Tremble UTSW 1 132611595 missense probably damaging 1.00
PIT4377001:Nfasc UTSW 1 132583066 missense unknown
R0240:Nfasc UTSW 1 132601983 missense probably damaging 1.00
R0240:Nfasc UTSW 1 132601983 missense probably damaging 1.00
R0241:Nfasc UTSW 1 132636993 missense probably benign 0.02
R0241:Nfasc UTSW 1 132636993 missense probably benign 0.02
R0418:Nfasc UTSW 1 132611595 missense probably damaging 1.00
R0513:Nfasc UTSW 1 132603846 missense possibly damaging 0.95
R0639:Nfasc UTSW 1 132603816 missense probably damaging 1.00
R0646:Nfasc UTSW 1 132608438 nonsense probably null
R1103:Nfasc UTSW 1 132607057 splice site probably benign
R1269:Nfasc UTSW 1 132610788 missense probably damaging 1.00
R1550:Nfasc UTSW 1 132608503 missense probably damaging 0.96
R1749:Nfasc UTSW 1 132611632 missense probably damaging 1.00
R1773:Nfasc UTSW 1 132610839 missense probably damaging 1.00
R1921:Nfasc UTSW 1 132610805 missense probably damaging 1.00
R1987:Nfasc UTSW 1 132610886 missense probably damaging 1.00
R2141:Nfasc UTSW 1 132596645 missense probably damaging 1.00
R2239:Nfasc UTSW 1 132583022 intron probably benign
R2413:Nfasc UTSW 1 132595505 missense probably damaging 1.00
R2428:Nfasc UTSW 1 132595654 missense possibly damaging 0.55
R2472:Nfasc UTSW 1 132588221 intron probably benign
R2517:Nfasc UTSW 1 132597763 unclassified probably null
R3850:Nfasc UTSW 1 132631733 missense probably damaging 1.00
R4050:Nfasc UTSW 1 132610305 splice site probably benign
R4061:Nfasc UTSW 1 132597845 missense probably damaging 1.00
R4088:Nfasc UTSW 1 132595591 missense probably damaging 1.00
R4342:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4343:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4345:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4452:Nfasc UTSW 1 132634671 missense probably damaging 1.00
R4818:Nfasc UTSW 1 132603830 missense possibly damaging 0.87
R4851:Nfasc UTSW 1 132602021 missense probably damaging 1.00
R5014:Nfasc UTSW 1 132584447 intron probably benign
R5768:Nfasc UTSW 1 132605145 missense probably benign 0.00
R6335:Nfasc UTSW 1 132576394 missense probably damaging 0.98
R6379:Nfasc UTSW 1 132570542 nonsense probably null
R6486:Nfasc UTSW 1 132605214 missense probably damaging 1.00
R7022:Nfasc UTSW 1 132621049 missense probably damaging 1.00
R7062:Nfasc UTSW 1 132601969 critical splice donor site probably null
R7084:Nfasc UTSW 1 132570509 missense unknown
R7275:Nfasc UTSW 1 132634263 missense probably damaging 1.00
R7286:Nfasc UTSW 1 132602052 missense probably damaging 1.00
R7682:Nfasc UTSW 1 132573773 missense unknown
R7838:Nfasc UTSW 1 132605549 missense probably damaging 1.00
R7871:Nfasc UTSW 1 132600013 missense not run
R7921:Nfasc UTSW 1 132605549 missense probably damaging 1.00
R7954:Nfasc UTSW 1 132600013 missense not run
R8083:Nfasc UTSW 1 132596582 missense probably benign 0.00
Z1176:Nfasc UTSW 1 132634638 missense probably benign 0.00
Z1177:Nfasc UTSW 1 132631838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGCGTTCTGTCTAGGAATC -3'
(R):5'- TGGAGTAGAAGTCTGCCATTGAG -3'

Sequencing Primer
(F):5'- AAGCGTTCTGTCTAGGAATCTTTCG -3'
(R):5'- CCATTGAGTGGGGACTAGAAACC -3'
Posted On2017-10-10