Mutagenetix > Incidental Mutation

Incidental Mutation 'R6145:Nfasc'

488783

Institutional Source

Beutler Lab

Gene Symbol

Nfasc

Ensembl Gene

ENSMUSG00000026442

Gene Name

neurofascin

Synonyms

D430023G06Rik

MMRRC Submission

044292-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6145 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

132564690-132741797 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 132634717 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 107 (G107R)

Ref Sequence

ENSEMBL: ENSMUSP00000139955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043189] [ENSMUST00000094569] [ENSMUST00000163770] [ENSMUST00000187861] [ENSMUST00000188307]

AlphaFold

Q810U3

Predicted Effect

probably damaging
Transcript: ENSMUST00000043189
AA Change: G101R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000035454
Gene: ENSMUSG00000026442
AA Change: G101R

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	42	131	4.5e0	SMART
IG	141	228	2.44e-7	SMART
IGc2	253	317	1.53e-17	SMART
IGc2	343	409	1.76e-8	SMART
IGc2	437	502	2.39e-10	SMART
IGc2	528	593	2.54e-5	SMART
FN3	607	690	2.17e-11	SMART
FN3	707	789	2.85e-6	SMART
FN3	805	896	2.21e-3	SMART
FN3	911	995	9.92e-6	SMART
low complexity region	996	1018	N/A	INTRINSIC
transmembrane domain	1026	1048	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1049	1133	1.4e-29	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000094569
AA Change: G107R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092148
Gene: ENSMUSG00000026442
AA Change: G107R

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	48	137	4.5e0	SMART
IG	147	234	2.44e-7	SMART
IGc2	259	323	1.53e-17	SMART
IGc2	349	415	1.76e-8	SMART
IGc2	443	508	2.39e-10	SMART
IGc2	534	599	2.54e-5	SMART
FN3	628	711	2.17e-11	SMART
FN3	728	810	2.85e-6	SMART
FN3	825	909	9.92e-6	SMART
FN3	1010	1086	6.91e-5	SMART
transmembrane domain	1109	1131	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1132	1216	2.2e-29	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000163770
AA Change: G101R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132979
Gene: ENSMUSG00000026442
AA Change: G101R

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	42	131	4.5e0	SMART
IG	141	228	2.44e-7	SMART
IGc2	270	334	1.53e-17	SMART
IGc2	360	426	1.76e-8	SMART
IGc2	454	519	2.39e-10	SMART
IGc2	545	610	2.54e-5	SMART
FN3	624	707	2.17e-11	SMART
FN3	724	806	2.85e-6	SMART
FN3	822	913	2.21e-3	SMART
FN3	928	1012	9.92e-6	SMART
low complexity region	1013	1035	N/A	INTRINSIC
transmembrane domain	1043	1065	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1066	1150	5e-30	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000186389
AA Change: G70R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000187861
AA Change: G107R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139955
Gene: ENSMUSG00000026442
AA Change: G107R

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	48	137	1.8e-2	SMART
IG	147	234	1e-9	SMART
IGc2	259	323	6.4e-20	SMART
IGc2	349	415	7e-11	SMART
IGc2	443	508	9.7e-13	SMART
IGc2	534	599	1.1e-7	SMART
FN3	628	711	1e-13	SMART
FN3	728	810	1.4e-8	SMART
FN3	826	917	1.1e-5	SMART
FN3	932	1016	4.8e-8	SMART
FN3	1117	1193	3.4e-7	SMART
transmembrane domain	1216	1238	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1239	1325	2.6e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000188307
AA Change: G101R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139520
Gene: ENSMUSG00000026442
AA Change: G101R

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	42	131	1.8e-2	SMART
IG	141	228	1e-9	SMART
IGc2	253	317	6.4e-20	SMART
IGc2	343	409	7e-11	SMART
IGc2	437	502	9.7e-13	SMART
IGc2	528	593	1.1e-7	SMART
FN3	622	705	1e-13	SMART
FN3	722	804	1.4e-8	SMART
FN3	820	890	3.8e-1	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 98.0%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes an L1 family immunoglobulin cell adhesion molecule with multiple IGcam and fibronectin domains. The protein functions in neurite outgrowth, neurite fasciculation, and organization of the axon initial segment (AIS) and nodes of Ranvier on axons during early development. Both the AIS and nodes of Ranvier contain high densities of voltage-gated Na+ (Nav) channels which are clustered by interactions with cytoskeletal and scaffolding proteins including this protein, gliomedin, ankyrin 3 (ankyrin-G), and betaIV spectrin. This protein links the AIS extracellular matrix to the intracellular cytoskeleton. This gene undergoes extensive alternative splicing, and the full-length nature of some variants has not been determined. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele die within 6 to 7 days of birth, exhibit reduced nerve conduction velocity and abnormal paranodal junction formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810459M11Rik	T	A	1: 86,052,942		probably null	Het
4930402H24Rik	T	C	2: 130,778,473	I247V	probably benign	Het
Abca8b	A	G	11: 109,973,808	V316A	probably benign	Het
Acad10	A	T	5: 121,622,033	V999D	probably damaging	Het
Acot8	A	G	2: 164,803,065	V66A	probably benign	Het
Ankrd11	T	C	8: 122,892,661	H1484R	probably damaging	Het
Anxa6	A	G	11: 54,994,904	F405S	probably damaging	Het
Asmt	G	A	X: 170,674,663	V101I	probably damaging	Het
Atp1a2	C	T	1: 172,287,238	V327I	probably damaging	Het
Brdt	A	G	5: 107,377,999	E906G	possibly damaging	Het
Cacna1g	A	T	11: 94,462,261	C313S	probably damaging	Het
Camk2d	T	C	3: 126,805,858	I329T	probably benign	Het
Cavin4	A	T	4: 48,663,794	H58L	probably damaging	Het
Ccdc78	C	A	17: 25,789,065	P317T	probably benign	Het
Cdc16	T	G	8: 13,767,573	Y295D	possibly damaging	Het
Cdyl2	T	A	8: 116,594,978	N270I	probably damaging	Het
Cfap221	T	A	1: 119,984,816	I114F	possibly damaging	Het
Dmxl1	A	G	18: 49,912,766	E2414G	possibly damaging	Het
Dnah1	C	A	14: 31,300,970	R1070L	probably benign	Het
Dnah14	T	C	1: 181,666,417	S1713P	probably benign	Het
Dock10	C	A	1: 80,575,904	G602*	probably null	Het
Ep400	A	T	5: 110,756,703	V10D	possibly damaging	Het
Epas1	T	C	17: 86,829,429	C807R	probably benign	Het
Esrrb	C	T	12: 86,505,899	P200L	probably benign	Het
Fbxw26	T	C	9: 109,732,623	I168V	probably benign	Het
Fsip2	A	T	2: 82,993,768	H6615L	possibly damaging	Het
Galk2	A	T	2: 125,946,842	Q272L	possibly damaging	Het
Gas7	A	C	11: 67,629,612	T43P	probably damaging	Het
Gm5134	A	T	10: 75,995,839	I371F	probably damaging	Het
Gpr31b	C	T	17: 13,051,379	R301Q	possibly damaging	Het
Grk1	T	A	8: 13,405,765	Y216*	probably null	Het
Grm5	T	A	7: 88,026,601	M441K	probably damaging	Het
Heatr6	A	G	11: 83,766,136	E408G	probably damaging	Het
Hoxc9	G	T	15: 102,983,959	K201N	probably damaging	Het
Igsf10	T	A	3: 59,331,656	Y368F	possibly damaging	Het
Il2ra	A	T	2: 11,680,246	D131V	probably damaging	Het
Imp4	A	G	1: 34,440,096	E19G	probably benign	Het
Kcnk18	T	C	19: 59,235,607	*395Q	probably null	Het
Kdm6b	A	T	11: 69,405,026	L805Q	unknown	Het
Lgr4	T	A	2: 110,007,243	L427*	probably null	Het
Myt1l	G	A	12: 29,832,381	S525N	unknown	Het
Nasp	G	A	4: 116,611,077	T237I	probably benign	Het
Nell2	G	T	15: 95,473,561	Q98K	probably damaging	Het
Nsun4	A	G	4: 116,040,206	S203P	probably damaging	Het
Olfr24	T	G	9: 18,755,569	D22A	probably benign	Het
Olfr855	T	C	9: 19,584,888	V117A	probably benign	Het
Otogl	G	A	10: 107,777,117		silent	Het
Pde10a	T	C	17: 8,929,117	V366A	probably damaging	Het
Pdxk	T	A	10: 78,443,791	D250V	probably benign	Het
Pih1d1	T	A	7: 45,159,044	I179N	probably damaging	Het
Plaa	T	A	4: 94,583,992	I294F	probably damaging	Het
Pmel	C	A	10: 128,715,935	P213T	probably damaging	Het
Pom121l2	A	T	13: 21,982,302	R248*	probably null	Het
Pou2f1	T	C	1: 165,875,433		probably benign	Het
Ppm1j	G	A	3: 104,781,379	R98H	probably damaging	Het
Prkdc	C	T	16: 15,772,073	P2600L	probably damaging	Het
Prom1	T	C	5: 44,029,649	N422S	probably benign	Het
Pspn	C	T	17: 56,999,467	C154Y	probably damaging	Het
Ptdss1	T	C	13: 66,972,637		probably null	Het
Rapgef1	A	G	2: 29,736,666	Y993C	probably damaging	Het
Scrn2	A	C	11: 97,032,853	T219P	probably benign	Het
Sec23ip	T	G	7: 128,778,484	S874R	probably damaging	Het
Sept4	G	A	11: 87,585,246		probably null	Het
Slc15a3	C	T	19: 10,857,251	L499F	probably damaging	Het
Spaca9	G	A	2: 28,693,781	R64W	probably damaging	Het
Sra1	A	G	18: 36,667,575	M193T	probably damaging	Het
Srsf4	G	T	4: 131,900,294		probably benign	Het
Syne1	T	C	10: 5,052,750	D8055G	probably damaging	Het
Syne4	T	A	7: 30,316,563		probably null	Het
Tbc1d24	C	A	17: 24,208,229	G253V	probably damaging	Het
Tbck	T	A	3: 132,732,215	I467N	probably damaging	Het
Tln1	T	A	4: 43,538,030	M1857L	possibly damaging	Het
Ttll2	T	C	17: 7,351,632	R299G	probably benign	Het
Ugt2b36	T	G	5: 87,066,213	E524A	probably benign	Het
Vmn2r124	C	T	17: 18,062,851	T269I	probably benign	Het
Vmn2r4	A	G	3: 64,406,943	F206L	probably benign	Het
Zfp346	A	G	13: 55,115,574	K156R	probably damaging	Het

Other mutations in Nfasc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00895:Nfasc	APN	1	132573798	nonsense	probably null
IGL01088:Nfasc	APN	1	132642776	utr 5 prime	probably benign
IGL01958:Nfasc	APN	1	132608438	nonsense	probably null
IGL01999:Nfasc	APN	1	132605247	splice site	probably benign
IGL02170:Nfasc	APN	1	132610366	nonsense	probably null
IGL02187:Nfasc	APN	1	132570481	missense	probably damaging	1.00
IGL02192:Nfasc	APN	1	132570481	missense	probably damaging	1.00
IGL02452:Nfasc	APN	1	132620924	critical splice donor site	probably null
IGL02698:Nfasc	APN	1	132634737	missense	probably benign	0.06
IGL02797:Nfasc	APN	1	132610448	missense	probably damaging	1.00
IGL03000:Nfasc	APN	1	132621509	splice site	probably benign
IGL03027:Nfasc	APN	1	132610469	missense	probably damaging	1.00
Fascist	UTSW	1	132611605	missense	probably damaging	1.00
jiggle	UTSW	1	132602021	missense	probably damaging	1.00
Partisan	UTSW	1	132605549	missense	probably damaging	1.00
Tremble	UTSW	1	132611595	missense	probably damaging	1.00
PIT4377001:Nfasc	UTSW	1	132583066	missense	unknown
R0240:Nfasc	UTSW	1	132601983	missense	probably damaging	1.00
R0240:Nfasc	UTSW	1	132601983	missense	probably damaging	1.00
R0241:Nfasc	UTSW	1	132636993	missense	probably benign	0.02
R0241:Nfasc	UTSW	1	132636993	missense	probably benign	0.02
R0418:Nfasc	UTSW	1	132611595	missense	probably damaging	1.00
R0513:Nfasc	UTSW	1	132603846	missense	possibly damaging	0.95
R0639:Nfasc	UTSW	1	132603816	missense	probably damaging	1.00
R0646:Nfasc	UTSW	1	132608438	nonsense	probably null
R1103:Nfasc	UTSW	1	132607057	splice site	probably benign
R1269:Nfasc	UTSW	1	132610788	missense	probably damaging	1.00
R1550:Nfasc	UTSW	1	132608503	missense	probably damaging	0.96
R1749:Nfasc	UTSW	1	132611632	missense	probably damaging	1.00
R1773:Nfasc	UTSW	1	132610839	missense	probably damaging	1.00
R1921:Nfasc	UTSW	1	132610805	missense	probably damaging	1.00
R1987:Nfasc	UTSW	1	132610886	missense	probably damaging	1.00
R2141:Nfasc	UTSW	1	132596645	missense	probably damaging	1.00
R2239:Nfasc	UTSW	1	132583022	intron	probably benign
R2413:Nfasc	UTSW	1	132595505	missense	probably damaging	1.00
R2428:Nfasc	UTSW	1	132595654	missense	possibly damaging	0.55
R2472:Nfasc	UTSW	1	132588221	intron	probably benign
R2517:Nfasc	UTSW	1	132597763	splice site	probably null
R3850:Nfasc	UTSW	1	132631733	missense	probably damaging	1.00
R4050:Nfasc	UTSW	1	132610305	splice site	probably benign
R4061:Nfasc	UTSW	1	132597845	missense	probably damaging	1.00
R4088:Nfasc	UTSW	1	132595591	missense	probably damaging	1.00
R4342:Nfasc	UTSW	1	132631705	missense	probably damaging	1.00
R4343:Nfasc	UTSW	1	132631705	missense	probably damaging	1.00
R4345:Nfasc	UTSW	1	132631705	missense	probably damaging	1.00
R4452:Nfasc	UTSW	1	132634671	missense	probably damaging	1.00
R4818:Nfasc	UTSW	1	132603830	missense	possibly damaging	0.87
R4851:Nfasc	UTSW	1	132602021	missense	probably damaging	1.00
R5014:Nfasc	UTSW	1	132584447	intron	probably benign
R5768:Nfasc	UTSW	1	132605145	missense	probably benign	0.00
R6335:Nfasc	UTSW	1	132576394	missense	probably damaging	0.98
R6379:Nfasc	UTSW	1	132570542	nonsense	probably null
R6486:Nfasc	UTSW	1	132605214	missense	probably damaging	1.00
R7022:Nfasc	UTSW	1	132621049	missense	probably damaging	1.00
R7062:Nfasc	UTSW	1	132601969	critical splice donor site	probably null
R7084:Nfasc	UTSW	1	132570509	missense	unknown
R7275:Nfasc	UTSW	1	132634263	missense	probably damaging	1.00
R7286:Nfasc	UTSW	1	132602052	missense	probably damaging	1.00
R7682:Nfasc	UTSW	1	132573773	missense	unknown
R7838:Nfasc	UTSW	1	132605549	missense	probably damaging	1.00
R7871:Nfasc	UTSW	1	132600013	missense	not run
R7938:Nfasc	UTSW	1	132605531	missense	probably damaging	1.00
R8083:Nfasc	UTSW	1	132596582	missense	probably benign	0.00
R8482:Nfasc	UTSW	1	132605089	missense	probably damaging	1.00
R9027:Nfasc	UTSW	1	132611605	missense	probably damaging	1.00
R9164:Nfasc	UTSW	1	132634806	missense	probably damaging	1.00
R9488:Nfasc	UTSW	1	132600128	missense	possibly damaging	0.68
R9651:Nfasc	UTSW	1	132600053	missense	probably benign	0.04
Z1176:Nfasc	UTSW	1	132634638	missense	probably benign	0.00
Z1177:Nfasc	UTSW	1	132631838	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAAGCGTTCTGTCTAGGAATC -3'
(R):5'- TGGAGTAGAAGTCTGCCATTGAG -3'

Sequencing Primer
(F):5'- AAGCGTTCTGTCTAGGAATCTTTCG -3'
(R):5'- CCATTGAGTGGGGACTAGAAACC -3'

Posted On

2017-10-10