Incidental Mutation 'R6145:Atp1a2'
ID488785
Institutional Source Beutler Lab
Gene Symbol Atp1a2
Ensembl Gene ENSMUSG00000007097
Gene NameATPase, Na+/K+ transporting, alpha 2 polypeptide
SynonymsAtpa-3
MMRRC Submission 044292-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6145 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location172271709-172298064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 172287238 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 327 (V327I)
Ref Sequence ENSEMBL: ENSMUSP00000095072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085913] [ENSMUST00000097464] [ENSMUST00000139528]
Predicted Effect probably damaging
Transcript: ENSMUST00000085913
AA Change: V327I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083077
Gene: ENSMUSG00000007097
AA Change: V327I

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 40 114 5.28e-19 SMART
Pfam:E1-E2_ATPase 132 363 2.5e-59 PFAM
Pfam:Hydrolase 368 726 4.5e-19 PFAM
Pfam:HAD 371 723 3.2e-18 PFAM
Pfam:Cation_ATPase 424 518 1.9e-25 PFAM
Pfam:Cation_ATPase_C 796 1005 1.4e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097464
AA Change: V327I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095072
Gene: ENSMUSG00000007097
AA Change: V327I

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 40 114 5.28e-19 SMART
Pfam:E1-E2_ATPase 133 364 1.9e-63 PFAM
Pfam:Hydrolase 368 726 2e-32 PFAM
Pfam:HAD 371 723 1.7e-15 PFAM
Pfam:Hydrolase_like2 424 518 1.3e-26 PFAM
Pfam:Cation_ATPase_C 796 947 3.2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137679
SMART Domains Protein: ENSMUSP00000117873
Gene: ENSMUSG00000007097

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 40 114 5.28e-19 SMART
Pfam:E1-E2_ATPase 133 364 1.2e-63 PFAM
Pfam:Hydrolase 368 613 8.5e-9 PFAM
Pfam:Hydrolase_like2 424 518 5.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139528
SMART Domains Protein: ENSMUSP00000134280
Gene: ENSMUSG00000038034

DomainStartEndE-ValueType
IG_like 19 84 3.66e1 SMART
low complexity region 92 103 N/A INTRINSIC
IG 106 222 2.3e-3 SMART
IG 246 370 9.49e-5 SMART
IG 382 508 3.59e-5 SMART
transmembrane domain 515 537 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155363
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 2 subunit. Mutations in this gene result in familial basilar or hemiplegic migraines, and in a rare syndrome known as alternating hemiplegia of childhood. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutants die immediately after birth from breathing failure, lack spontaneous respiratory rhythm activity, have elevated levels of extracellular GABA in the brain, and have abnormal chloride homeostasis in brainstem neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 86,052,942 probably null Het
4930402H24Rik T C 2: 130,778,473 I247V probably benign Het
Abca8b A G 11: 109,973,808 V316A probably benign Het
Acad10 A T 5: 121,622,033 V999D probably damaging Het
Acot8 A G 2: 164,803,065 V66A probably benign Het
Ankrd11 T C 8: 122,892,661 H1484R probably damaging Het
Anxa6 A G 11: 54,994,904 F405S probably damaging Het
Asmt G A X: 170,674,663 V101I probably damaging Het
Brdt A G 5: 107,377,999 E906G possibly damaging Het
Cacna1g A T 11: 94,462,261 C313S probably damaging Het
Camk2d T C 3: 126,805,858 I329T probably benign Het
Cavin4 A T 4: 48,663,794 H58L probably damaging Het
Ccdc78 C A 17: 25,789,065 P317T probably benign Het
Cdc16 T G 8: 13,767,573 Y295D possibly damaging Het
Cdyl2 T A 8: 116,594,978 N270I probably damaging Het
Cfap221 T A 1: 119,984,816 I114F possibly damaging Het
Dmxl1 A G 18: 49,912,766 E2414G possibly damaging Het
Dnah1 C A 14: 31,300,970 R1070L probably benign Het
Dnah14 T C 1: 181,666,417 S1713P probably benign Het
Dock10 C A 1: 80,575,904 G602* probably null Het
Ep400 A T 5: 110,756,703 V10D possibly damaging Het
Epas1 T C 17: 86,829,429 C807R probably benign Het
Esrrb C T 12: 86,505,899 P200L probably benign Het
Fbxw26 T C 9: 109,732,623 I168V probably benign Het
Fsip2 A T 2: 82,993,768 H6615L possibly damaging Het
Galk2 A T 2: 125,946,842 Q272L possibly damaging Het
Gas7 A C 11: 67,629,612 T43P probably damaging Het
Gm5134 A T 10: 75,995,839 I371F probably damaging Het
Gpr31b C T 17: 13,051,379 R301Q possibly damaging Het
Grk1 T A 8: 13,405,765 Y216* probably null Het
Grm5 T A 7: 88,026,601 M441K probably damaging Het
Heatr6 A G 11: 83,766,136 E408G probably damaging Het
Hoxc9 G T 15: 102,983,959 K201N probably damaging Het
Igsf10 T A 3: 59,331,656 Y368F possibly damaging Het
Il2ra A T 2: 11,680,246 D131V probably damaging Het
Imp4 A G 1: 34,440,096 E19G probably benign Het
Kcnk18 T C 19: 59,235,607 *395Q probably null Het
Kdm6b A T 11: 69,405,026 L805Q unknown Het
Lgr4 T A 2: 110,007,243 L427* probably null Het
Myt1l G A 12: 29,832,381 S525N unknown Het
Nasp G A 4: 116,611,077 T237I probably benign Het
Nell2 G T 15: 95,473,561 Q98K probably damaging Het
Nfasc C T 1: 132,634,717 G107R probably damaging Het
Nsun4 A G 4: 116,040,206 S203P probably damaging Het
Olfr24 T G 9: 18,755,569 D22A probably benign Het
Olfr855 T C 9: 19,584,888 V117A probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pde10a T C 17: 8,929,117 V366A probably damaging Het
Pdxk T A 10: 78,443,791 D250V probably benign Het
Pih1d1 T A 7: 45,159,044 I179N probably damaging Het
Plaa T A 4: 94,583,992 I294F probably damaging Het
Pmel C A 10: 128,715,935 P213T probably damaging Het
Pom121l2 A T 13: 21,982,302 R248* probably null Het
Pou2f1 T C 1: 165,875,433 probably benign Het
Ppm1j G A 3: 104,781,379 R98H probably damaging Het
Prkdc C T 16: 15,772,073 P2600L probably damaging Het
Prom1 T C 5: 44,029,649 N422S probably benign Het
Pspn C T 17: 56,999,467 C154Y probably damaging Het
Ptdss1 T C 13: 66,972,637 probably null Het
Rapgef1 A G 2: 29,736,666 Y993C probably damaging Het
Scrn2 A C 11: 97,032,853 T219P probably benign Het
Sec23ip T G 7: 128,778,484 S874R probably damaging Het
Sept4 G A 11: 87,585,246 probably null Het
Slc15a3 C T 19: 10,857,251 L499F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sra1 A G 18: 36,667,575 M193T probably damaging Het
Srsf4 G T 4: 131,900,294 probably benign Het
Syne1 T C 10: 5,052,750 D8055G probably damaging Het
Syne4 T A 7: 30,316,563 probably null Het
Tbc1d24 C A 17: 24,208,229 G253V probably damaging Het
Tbck T A 3: 132,732,215 I467N probably damaging Het
Tln1 T A 4: 43,538,030 M1857L possibly damaging Het
Ttll2 T C 17: 7,351,632 R299G probably benign Het
Ugt2b36 T G 5: 87,066,213 E524A probably benign Het
Vmn2r124 C T 17: 18,062,851 T269I probably benign Het
Vmn2r4 A G 3: 64,406,943 F206L probably benign Het
Zfp346 A G 13: 55,115,574 K156R probably damaging Het
Other mutations in Atp1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Atp1a2 APN 1 172276002 missense probably damaging 1.00
IGL00954:Atp1a2 APN 1 172290634 missense probably damaging 1.00
IGL01083:Atp1a2 APN 1 172284619 missense probably benign
IGL01372:Atp1a2 APN 1 172278943 missense probably damaging 1.00
IGL01762:Atp1a2 APN 1 172284913 missense possibly damaging 0.89
IGL01896:Atp1a2 APN 1 172286011 missense probably damaging 1.00
IGL01942:Atp1a2 APN 1 172286309 missense probably benign 0.35
IGL01944:Atp1a2 APN 1 172276187 missense probably damaging 0.98
IGL02219:Atp1a2 APN 1 172279718 missense probably damaging 1.00
IGL02219:Atp1a2 APN 1 172279731 nonsense probably null
IGL02304:Atp1a2 APN 1 172289353 missense probably benign
IGL02507:Atp1a2 APN 1 172285771 missense probably damaging 1.00
IGL02557:Atp1a2 APN 1 172278651 missense possibly damaging 0.83
IGL02632:Atp1a2 APN 1 172280614 missense possibly damaging 0.89
IGL03053:Atp1a2 APN 1 172278356 missense probably damaging 1.00
IGL03104:Atp1a2 APN 1 172293367 missense probably damaging 0.97
IGL03161:Atp1a2 APN 1 172278862 intron probably benign
IGL03218:Atp1a2 APN 1 172289303 missense probably null 0.82
PIT4151001:Atp1a2 UTSW 1 172290721 missense probably damaging 0.99
PIT4520001:Atp1a2 UTSW 1 172279374 missense probably benign 0.00
R0121:Atp1a2 UTSW 1 172289342 missense probably damaging 0.99
R0630:Atp1a2 UTSW 1 172291275 missense possibly damaging 0.78
R0682:Atp1a2 UTSW 1 172284597 missense probably benign 0.00
R0755:Atp1a2 UTSW 1 172289381 missense probably benign 0.37
R1413:Atp1a2 UTSW 1 172279344 missense probably damaging 1.00
R1680:Atp1a2 UTSW 1 172278954 missense probably damaging 0.99
R2094:Atp1a2 UTSW 1 172287433 missense probably damaging 1.00
R3714:Atp1a2 UTSW 1 172278984 missense probably damaging 0.96
R4573:Atp1a2 UTSW 1 172278637 missense possibly damaging 0.75
R4928:Atp1a2 UTSW 1 172278387 missense possibly damaging 0.93
R4953:Atp1a2 UTSW 1 172291442 intron probably benign
R5014:Atp1a2 UTSW 1 172284871 missense probably benign 0.05
R5080:Atp1a2 UTSW 1 172284445 intron probably benign
R5129:Atp1a2 UTSW 1 172275955 missense probably benign 0.02
R5360:Atp1a2 UTSW 1 172278869 critical splice donor site probably null
R5619:Atp1a2 UTSW 1 172279381 missense probably damaging 0.99
R5622:Atp1a2 UTSW 1 172291427 intron probably benign
R5718:Atp1a2 UTSW 1 172279442 missense probably damaging 1.00
R5729:Atp1a2 UTSW 1 172293371 missense probably damaging 0.99
R5909:Atp1a2 UTSW 1 172287230 missense probably damaging 1.00
R6018:Atp1a2 UTSW 1 172298012 intron probably benign
R6164:Atp1a2 UTSW 1 172278892 missense probably damaging 0.97
R6315:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6317:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6319:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6323:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6324:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6374:Atp1a2 UTSW 1 172289375 missense probably damaging 1.00
R6764:Atp1a2 UTSW 1 172284614 missense probably benign
R6812:Atp1a2 UTSW 1 172284877 missense probably benign 0.20
R7025:Atp1a2 UTSW 1 172284550 nonsense probably null
R7194:Atp1a2 UTSW 1 172280627 nonsense probably null
R7459:Atp1a2 UTSW 1 172287295 missense probably benign 0.00
R7791:Atp1a2 UTSW 1 172276215 missense probably benign 0.28
R7972:Atp1a2 UTSW 1 172278064 intron probably null
Z1176:Atp1a2 UTSW 1 172279754 missense possibly damaging 0.90
Z1177:Atp1a2 UTSW 1 172287336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGAATGCTCAGATACAGCTCAAC -3'
(R):5'- ATAGCCACTCTTGCCTCTGG -3'

Sequencing Primer
(F):5'- AGGCATGCCCTGAACAATTTCTG -3'
(R):5'- TCTGGCCTAGAGGTGGGAC -3'
Posted On2017-10-10