Incidental Mutation 'R6145:Il2ra'
ID 488787
Institutional Source Beutler Lab
Gene Symbol Il2ra
Ensembl Gene ENSMUSG00000026770
Gene Name interleukin 2 receptor, alpha chain
Synonyms CD25, Ly-43, Il2r, IL-2R alpha chain
MMRRC Submission 044292-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6145 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 11642807-11693193 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 11680246 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 131 (D131V)
Ref Sequence ENSEMBL: ENSMUSP00000028111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028111]
AlphaFold P01590
Predicted Effect probably damaging
Transcript: ENSMUST00000028111
AA Change: D131V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028111
Gene: ENSMUSG00000026770
AA Change: D131V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CCP 24 77 5e-2 SMART
CCP 121 180 1.2e-4 SMART
low complexity region 212 223 N/A INTRINSIC
transmembrane domain 235 257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195427
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The interleukin 2 (IL2) receptor alpha (IL2RA) and beta (IL2RB) chains, together with the common gamma chain (IL2RG), constitute the high-affinity IL2 receptor. Homodimeric alpha chains (IL2RA) result in low-affinity receptor, while homodimeric beta (IL2RB) chains produce a medium-affinity receptor. Normally an integral-membrane protein, soluble IL2RA has been isolated and determined to result from extracellular proteolyisis. Alternately-spliced IL2RA mRNAs have been isolated, but the significance of each is presently unknown. Mutations in this gene are associated with interleukin 2 receptor alpha deficiency.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit massive proliferation of polyclonal T and B cells as adults and develop autoimmune disorders including inflammatory bowel disease and hemolytic anemia with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 86,052,942 probably null Het
4930402H24Rik T C 2: 130,778,473 I247V probably benign Het
Abca8b A G 11: 109,973,808 V316A probably benign Het
Acad10 A T 5: 121,622,033 V999D probably damaging Het
Acot8 A G 2: 164,803,065 V66A probably benign Het
Ankrd11 T C 8: 122,892,661 H1484R probably damaging Het
Anxa6 A G 11: 54,994,904 F405S probably damaging Het
Asmt G A X: 170,674,663 V101I probably damaging Het
Atp1a2 C T 1: 172,287,238 V327I probably damaging Het
Brdt A G 5: 107,377,999 E906G possibly damaging Het
Cacna1g A T 11: 94,462,261 C313S probably damaging Het
Camk2d T C 3: 126,805,858 I329T probably benign Het
Cavin4 A T 4: 48,663,794 H58L probably damaging Het
Ccdc78 C A 17: 25,789,065 P317T probably benign Het
Cdc16 T G 8: 13,767,573 Y295D possibly damaging Het
Cdyl2 T A 8: 116,594,978 N270I probably damaging Het
Cfap221 T A 1: 119,984,816 I114F possibly damaging Het
Dmxl1 A G 18: 49,912,766 E2414G possibly damaging Het
Dnah1 C A 14: 31,300,970 R1070L probably benign Het
Dnah14 T C 1: 181,666,417 S1713P probably benign Het
Dock10 C A 1: 80,575,904 G602* probably null Het
Ep400 A T 5: 110,756,703 V10D possibly damaging Het
Epas1 T C 17: 86,829,429 C807R probably benign Het
Esrrb C T 12: 86,505,899 P200L probably benign Het
Fbxw26 T C 9: 109,732,623 I168V probably benign Het
Fsip2 A T 2: 82,993,768 H6615L possibly damaging Het
Galk2 A T 2: 125,946,842 Q272L possibly damaging Het
Gas7 A C 11: 67,629,612 T43P probably damaging Het
Gm5134 A T 10: 75,995,839 I371F probably damaging Het
Gpr31b C T 17: 13,051,379 R301Q possibly damaging Het
Grk1 T A 8: 13,405,765 Y216* probably null Het
Grm5 T A 7: 88,026,601 M441K probably damaging Het
Heatr6 A G 11: 83,766,136 E408G probably damaging Het
Hoxc9 G T 15: 102,983,959 K201N probably damaging Het
Igsf10 T A 3: 59,331,656 Y368F possibly damaging Het
Imp4 A G 1: 34,440,096 E19G probably benign Het
Kcnk18 T C 19: 59,235,607 *395Q probably null Het
Kdm6b A T 11: 69,405,026 L805Q unknown Het
Lgr4 T A 2: 110,007,243 L427* probably null Het
Myt1l G A 12: 29,832,381 S525N unknown Het
Nasp G A 4: 116,611,077 T237I probably benign Het
Nell2 G T 15: 95,473,561 Q98K probably damaging Het
Nfasc C T 1: 132,634,717 G107R probably damaging Het
Nsun4 A G 4: 116,040,206 S203P probably damaging Het
Olfr24 T G 9: 18,755,569 D22A probably benign Het
Olfr855 T C 9: 19,584,888 V117A probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pde10a T C 17: 8,929,117 V366A probably damaging Het
Pdxk T A 10: 78,443,791 D250V probably benign Het
Pih1d1 T A 7: 45,159,044 I179N probably damaging Het
Plaa T A 4: 94,583,992 I294F probably damaging Het
Pmel C A 10: 128,715,935 P213T probably damaging Het
Pom121l2 A T 13: 21,982,302 R248* probably null Het
Pou2f1 T C 1: 165,875,433 probably benign Het
Ppm1j G A 3: 104,781,379 R98H probably damaging Het
Prkdc C T 16: 15,772,073 P2600L probably damaging Het
Prom1 T C 5: 44,029,649 N422S probably benign Het
Pspn C T 17: 56,999,467 C154Y probably damaging Het
Ptdss1 T C 13: 66,972,637 probably null Het
Rapgef1 A G 2: 29,736,666 Y993C probably damaging Het
Scrn2 A C 11: 97,032,853 T219P probably benign Het
Sec23ip T G 7: 128,778,484 S874R probably damaging Het
Sept4 G A 11: 87,585,246 probably null Het
Slc15a3 C T 19: 10,857,251 L499F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sra1 A G 18: 36,667,575 M193T probably damaging Het
Srsf4 G T 4: 131,900,294 probably benign Het
Syne1 T C 10: 5,052,750 D8055G probably damaging Het
Syne4 T A 7: 30,316,563 probably null Het
Tbc1d24 C A 17: 24,208,229 G253V probably damaging Het
Tbck T A 3: 132,732,215 I467N probably damaging Het
Tln1 T A 4: 43,538,030 M1857L possibly damaging Het
Ttll2 T C 17: 7,351,632 R299G probably benign Het
Ugt2b36 T G 5: 87,066,213 E524A probably benign Het
Vmn2r124 C T 17: 18,062,851 T269I probably benign Het
Vmn2r4 A G 3: 64,406,943 F206L probably benign Het
Zfp346 A G 13: 55,115,574 K156R probably damaging Het
Other mutations in Il2ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Il2ra APN 2 11683099 missense probably benign 0.12
IGL01393:Il2ra APN 2 11683054 missense probably damaging 0.99
IGL01594:Il2ra APN 2 11680396 missense possibly damaging 0.85
IGL02519:Il2ra APN 2 11683090 missense possibly damaging 0.91
R0206:Il2ra UTSW 2 11682017 splice site probably benign
R0208:Il2ra UTSW 2 11682017 splice site probably benign
R0635:Il2ra UTSW 2 11680366 missense probably benign 0.38
R0666:Il2ra UTSW 2 11643073 splice site probably benign
R4732:Il2ra UTSW 2 11676920 missense probably benign
R4733:Il2ra UTSW 2 11676920 missense probably benign
R4959:Il2ra UTSW 2 11676853 missense possibly damaging 0.91
R5006:Il2ra UTSW 2 11674346 missense possibly damaging 0.83
R5531:Il2ra UTSW 2 11676892 missense possibly damaging 0.91
R5899:Il2ra UTSW 2 11684437 missense probably benign
R6184:Il2ra UTSW 2 11647979 intron probably benign
R6449:Il2ra UTSW 2 11680362 missense probably benign
R6472:Il2ra UTSW 2 11681969 missense possibly damaging 0.91
R7300:Il2ra UTSW 2 11676910 missense not run
R7371:Il2ra UTSW 2 11643020 missense probably benign 0.07
R7855:Il2ra UTSW 2 11680336 missense possibly damaging 0.65
R7922:Il2ra UTSW 2 11674366 missense possibly damaging 0.93
R7963:Il2ra UTSW 2 11674424 missense probably benign 0.05
R8338:Il2ra UTSW 2 11683074 missense probably benign
R9193:Il2ra UTSW 2 11684391 missense possibly damaging 0.85
R9418:Il2ra UTSW 2 11684392 missense possibly damaging 0.93
R9634:Il2ra UTSW 2 11680416 nonsense probably null
R9789:Il2ra UTSW 2 11680350 missense probably benign 0.00
Z1176:Il2ra UTSW 2 11681931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCCTACATTTCTGACAGCTG -3'
(R):5'- TACCCAGAAATCGGTGGTGTTC -3'

Sequencing Primer
(F):5'- CACTTGTAGGTTCAGTGAAAGC -3'
(R):5'- CCAGAAATCGGTGGTGTTCTCTTTC -3'
Posted On 2017-10-10