Incidental Mutation 'R6145:Rapgef1'
ID488789
Institutional Source Beutler Lab
Gene Symbol Rapgef1
Ensembl Gene ENSMUSG00000039844
Gene NameRap guanine nucleotide exchange factor (GEF) 1
SynonymsGrf2, 4932418O06Rik, C3G
MMRRC Submission 044292-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6145 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location29619720-29740978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29736666 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 993 (Y993C)
Ref Sequence ENSEMBL: ENSMUSP00000099936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091146] [ENSMUST00000095087] [ENSMUST00000102872] [ENSMUST00000147755]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000051212
Predicted Effect probably damaging
Transcript: ENSMUST00000091146
AA Change: Y1125C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088680
Gene: ENSMUSG00000039844
AA Change: Y1125C

DomainStartEndE-ValueType
low complexity region 191 206 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 468 478 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 664 682 N/A INTRINSIC
low complexity region 689 700 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
RasGEFN 828 970 8.04e-37 SMART
RasGEF 977 1206 5.85e-102 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095087
AA Change: Y1131C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092703
Gene: ENSMUSG00000039844
AA Change: Y1131C

DomainStartEndE-ValueType
low complexity region 229 244 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
low complexity region 506 516 N/A INTRINSIC
low complexity region 548 559 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
low complexity region 702 720 N/A INTRINSIC
low complexity region 727 738 N/A INTRINSIC
RasGEFN 834 976 8.04e-37 SMART
RasGEF 983 1212 5.85e-102 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102872
AA Change: Y993C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099936
Gene: ENSMUSG00000039844
AA Change: Y993C

DomainStartEndE-ValueType
low complexity region 229 244 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
low complexity region 506 516 N/A INTRINSIC
low complexity region 548 559 N/A INTRINSIC
RasGEFN 696 838 8.04e-37 SMART
RasGEF 845 1074 5.85e-102 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137719
Predicted Effect unknown
Transcript: ENSMUST00000147488
AA Change: Y549C
SMART Domains Protein: ENSMUSP00000117631
Gene: ENSMUSG00000039844
AA Change: Y549C

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
RasGEFN 253 395 8.04e-37 SMART
RasGEF 402 631 5.85e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147755
SMART Domains Protein: ENSMUSP00000121615
Gene: ENSMUSG00000039844

DomainStartEndE-ValueType
low complexity region 191 206 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 468 478 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 591 602 N/A INTRINSIC
low complexity region 663 681 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human guanine nucleotide exchange factor. It transduces signals from CRK by binding the SH3 domain of CRK, and activating several members of the Ras family of GTPases. This signaling cascade that may be involved in apoptosis, integrin-mediated signal transduction, and cell transformation. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die before E7.5. Mice homozygous for a hypomorphic gene trap allele show embryonic lethality during organogenesis, altered neuroepithelium morphology, vascular maturation defects, hemorrhage, and reduced cell migration and adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 86,052,942 probably null Het
4930402H24Rik T C 2: 130,778,473 I247V probably benign Het
Abca8b A G 11: 109,973,808 V316A probably benign Het
Acad10 A T 5: 121,622,033 V999D probably damaging Het
Acot8 A G 2: 164,803,065 V66A probably benign Het
Ankrd11 T C 8: 122,892,661 H1484R probably damaging Het
Anxa6 A G 11: 54,994,904 F405S probably damaging Het
Asmt G A X: 170,674,663 V101I probably damaging Het
Atp1a2 C T 1: 172,287,238 V327I probably damaging Het
Brdt A G 5: 107,377,999 E906G possibly damaging Het
Cacna1g A T 11: 94,462,261 C313S probably damaging Het
Camk2d T C 3: 126,805,858 I329T probably benign Het
Cavin4 A T 4: 48,663,794 H58L probably damaging Het
Ccdc78 C A 17: 25,789,065 P317T probably benign Het
Cdc16 T G 8: 13,767,573 Y295D possibly damaging Het
Cdyl2 T A 8: 116,594,978 N270I probably damaging Het
Cfap221 T A 1: 119,984,816 I114F possibly damaging Het
Dmxl1 A G 18: 49,912,766 E2414G possibly damaging Het
Dnah1 C A 14: 31,300,970 R1070L probably benign Het
Dnah14 T C 1: 181,666,417 S1713P probably benign Het
Dock10 C A 1: 80,575,904 G602* probably null Het
Ep400 A T 5: 110,756,703 V10D possibly damaging Het
Epas1 T C 17: 86,829,429 C807R probably benign Het
Esrrb C T 12: 86,505,899 P200L probably benign Het
Fbxw26 T C 9: 109,732,623 I168V probably benign Het
Fsip2 A T 2: 82,993,768 H6615L possibly damaging Het
Galk2 A T 2: 125,946,842 Q272L possibly damaging Het
Gas7 A C 11: 67,629,612 T43P probably damaging Het
Gm5134 A T 10: 75,995,839 I371F probably damaging Het
Gpr31b C T 17: 13,051,379 R301Q possibly damaging Het
Grk1 T A 8: 13,405,765 Y216* probably null Het
Grm5 T A 7: 88,026,601 M441K probably damaging Het
Heatr6 A G 11: 83,766,136 E408G probably damaging Het
Hoxc9 G T 15: 102,983,959 K201N probably damaging Het
Igsf10 T A 3: 59,331,656 Y368F possibly damaging Het
Il2ra A T 2: 11,680,246 D131V probably damaging Het
Imp4 A G 1: 34,440,096 E19G probably benign Het
Kcnk18 T C 19: 59,235,607 *395Q probably null Het
Kdm6b A T 11: 69,405,026 L805Q unknown Het
Lgr4 T A 2: 110,007,243 L427* probably null Het
Myt1l G A 12: 29,832,381 S525N unknown Het
Nasp G A 4: 116,611,077 T237I probably benign Het
Nell2 G T 15: 95,473,561 Q98K probably damaging Het
Nfasc C T 1: 132,634,717 G107R probably damaging Het
Nsun4 A G 4: 116,040,206 S203P probably damaging Het
Olfr24 T G 9: 18,755,569 D22A probably benign Het
Olfr855 T C 9: 19,584,888 V117A probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pde10a T C 17: 8,929,117 V366A probably damaging Het
Pdxk T A 10: 78,443,791 D250V probably benign Het
Pih1d1 T A 7: 45,159,044 I179N probably damaging Het
Plaa T A 4: 94,583,992 I294F probably damaging Het
Pmel C A 10: 128,715,935 P213T probably damaging Het
Pom121l2 A T 13: 21,982,302 R248* probably null Het
Pou2f1 T C 1: 165,875,433 probably benign Het
Ppm1j G A 3: 104,781,379 R98H probably damaging Het
Prkdc C T 16: 15,772,073 P2600L probably damaging Het
Prom1 T C 5: 44,029,649 N422S probably benign Het
Pspn C T 17: 56,999,467 C154Y probably damaging Het
Ptdss1 T C 13: 66,972,637 probably null Het
Scrn2 A C 11: 97,032,853 T219P probably benign Het
Sec23ip T G 7: 128,778,484 S874R probably damaging Het
Sept4 G A 11: 87,585,246 probably null Het
Slc15a3 C T 19: 10,857,251 L499F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sra1 A G 18: 36,667,575 M193T probably damaging Het
Srsf4 G T 4: 131,900,294 probably benign Het
Syne1 T C 10: 5,052,750 D8055G probably damaging Het
Syne4 T A 7: 30,316,563 probably null Het
Tbc1d24 C A 17: 24,208,229 G253V probably damaging Het
Tbck T A 3: 132,732,215 I467N probably damaging Het
Tln1 T A 4: 43,538,030 M1857L possibly damaging Het
Ttll2 T C 17: 7,351,632 R299G probably benign Het
Ugt2b36 T G 5: 87,066,213 E524A probably benign Het
Vmn2r124 C T 17: 18,062,851 T269I probably benign Het
Vmn2r4 A G 3: 64,406,943 F206L probably benign Het
Zfp346 A G 13: 55,115,574 K156R probably damaging Het
Other mutations in Rapgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Rapgef1 APN 2 29722269 missense probably benign
IGL00917:Rapgef1 APN 2 29702523 missense probably benign 0.00
IGL02618:Rapgef1 APN 2 29737943 missense probably damaging 1.00
IGL02642:Rapgef1 APN 2 29700860 splice site probably benign
IGL02974:Rapgef1 APN 2 29710216 missense possibly damaging 0.64
R0034:Rapgef1 UTSW 2 29724768 splice site probably benign
R0034:Rapgef1 UTSW 2 29724768 splice site probably benign
R0241:Rapgef1 UTSW 2 29702670 missense possibly damaging 0.53
R0241:Rapgef1 UTSW 2 29702670 missense possibly damaging 0.53
R0279:Rapgef1 UTSW 2 29726227 missense probably damaging 1.00
R0432:Rapgef1 UTSW 2 29679816 missense possibly damaging 0.86
R1817:Rapgef1 UTSW 2 29686256 missense probably damaging 1.00
R1837:Rapgef1 UTSW 2 29737426 missense probably damaging 1.00
R1970:Rapgef1 UTSW 2 29733711 missense probably damaging 1.00
R1980:Rapgef1 UTSW 2 29722227 missense probably benign
R2076:Rapgef1 UTSW 2 29702508 missense probably benign 0.00
R2363:Rapgef1 UTSW 2 29736596 missense possibly damaging 0.63
R3016:Rapgef1 UTSW 2 29707393 missense probably damaging 1.00
R3053:Rapgef1 UTSW 2 29724856 missense probably damaging 1.00
R3777:Rapgef1 UTSW 2 29719689 missense possibly damaging 0.67
R3980:Rapgef1 UTSW 2 29719650 missense probably benign 0.33
R4491:Rapgef1 UTSW 2 29719656 missense possibly damaging 0.93
R4524:Rapgef1 UTSW 2 29679246 missense probably benign 0.00
R4732:Rapgef1 UTSW 2 29689160 missense probably damaging 1.00
R4733:Rapgef1 UTSW 2 29689160 missense probably damaging 1.00
R5391:Rapgef1 UTSW 2 29737965 missense probably damaging 1.00
R5395:Rapgef1 UTSW 2 29737965 missense probably damaging 1.00
R5611:Rapgef1 UTSW 2 29702436 missense probably damaging 0.96
R6062:Rapgef1 UTSW 2 29700732 missense probably damaging 0.96
R6580:Rapgef1 UTSW 2 29730609 missense possibly damaging 0.95
R6892:Rapgef1 UTSW 2 29699840 critical splice donor site probably null
R6897:Rapgef1 UTSW 2 29702502 missense probably damaging 1.00
R6957:Rapgef1 UTSW 2 29733698 missense possibly damaging 0.62
R7039:Rapgef1 UTSW 2 29726214 missense probably damaging 0.97
R7149:Rapgef1 UTSW 2 29720700 missense probably damaging 0.98
R7253:Rapgef1 UTSW 2 29699721 missense possibly damaging 0.72
R7315:Rapgef1 UTSW 2 29734492 missense probably damaging 0.98
RF005:Rapgef1 UTSW 2 29707195 splice site probably null
Predicted Primers PCR Primer
(F):5'- CACTATTAGCAGGCGTCCAC -3'
(R):5'- AATGCCAAACTGTTAACTGAGC -3'

Sequencing Primer
(F):5'- CCACAGGGCTTTCGTTGGTATC -3'
(R):5'- GCCTTTGCAGAACACTTGG -3'
Posted On2017-10-10