Mutagenetix > Incidental Mutation

Incidental Mutation 'R6145:Lgr4'

488791

Institutional Source

Beutler Lab

Gene Symbol

Lgr4

Ensembl Gene

ENSMUSG00000050199

Gene Name

leucine-rich repeat-containing G protein-coupled receptor 4

Synonyms

A930009A08Rik, Gpr48, A330106J01Rik

MMRRC Submission

044292-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6145 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

109917647-110014257 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 110007243 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 427 (L427*)

Ref Sequence

ENSEMBL: ENSMUSP00000106666 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046548] [ENSMUST00000111037]

AlphaFold

A2ARI4

Predicted Effect

probably null
Transcript: ENSMUST00000046548
AA Change: L451*

SMART Domains

Protein: ENSMUSP00000047325
Gene: ENSMUSG00000050199
AA Change: L451*

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
LRRNT	28	61	6.68e-6	SMART
LRR	55	79	1.49e1	SMART
LRR	80	103	1.99e0	SMART
LRR_TYP	104	127	2.75e-3	SMART
LRR_TYP	128	151	2.79e-4	SMART
LRR	152	175	2.54e1	SMART
LRR	176	199	4.65e-1	SMART
LRR_TYP	200	223	1.04e-3	SMART
LRR	224	246	6.4e0	SMART
LRR_TYP	247	270	5.99e-4	SMART
LRR	272	294	9.77e1	SMART
LRR	318	341	3e1	SMART
LRR	343	363	4.71e1	SMART
LRR	364	387	1.49e1	SMART
LRR_TYP	388	411	1.15e-5	SMART
LRR	412	435	3.98e1	SMART
low complexity region	500	516	N/A	INTRINSIC
Pfam:7tm_1	555	801	2.7e-10	PFAM
low complexity region	824	837	N/A	INTRINSIC
low complexity region	910	924	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000111037
AA Change: L427*

SMART Domains

Protein: ENSMUSP00000106666
Gene: ENSMUSG00000050199
AA Change: L427*

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
LRRNT	28	61	6.68e-6	SMART
LRR	55	79	9.77e1	SMART
LRR_TYP	80	103	2.75e-3	SMART
LRR_TYP	104	127	2.79e-4	SMART
LRR	128	151	2.54e1	SMART
LRR	152	175	4.65e-1	SMART
LRR_TYP	176	199	1.04e-3	SMART
LRR	200	222	6.4e0	SMART
LRR_TYP	223	246	5.99e-4	SMART
LRR	248	270	9.77e1	SMART
LRR	294	317	3e1	SMART
LRR	319	339	4.71e1	SMART
LRR	340	363	1.49e1	SMART
LRR_TYP	364	387	1.15e-5	SMART
LRR	388	411	3.98e1	SMART
low complexity region	476	492	N/A	INTRINSIC
Pfam:7tm_1	531	777	9.3e-17	PFAM
low complexity region	800	813	N/A	INTRINSIC
low complexity region	886	900	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 98.0%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor that binds R-spondins and activates the Wnt signaling pathway. This Wnt signaling pathway activation is necessary for proper development of many organs of the body. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a knock-out allele show embryonic and perinatal death, open eyelids, and abnormal renal development. One gene trap mutation leads to reduced body weight, sterility, and impaired male reproductive tract development. Another gene trap mutation causes ocular anterior segment anomalies. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810459M11Rik	T	A	1: 86,052,942		probably null	Het
4930402H24Rik	T	C	2: 130,778,473	I247V	probably benign	Het
Abca8b	A	G	11: 109,973,808	V316A	probably benign	Het
Acad10	A	T	5: 121,622,033	V999D	probably damaging	Het
Acot8	A	G	2: 164,803,065	V66A	probably benign	Het
Ankrd11	T	C	8: 122,892,661	H1484R	probably damaging	Het
Anxa6	A	G	11: 54,994,904	F405S	probably damaging	Het
Asmt	G	A	X: 170,674,663	V101I	probably damaging	Het
Atp1a2	C	T	1: 172,287,238	V327I	probably damaging	Het
Brdt	A	G	5: 107,377,999	E906G	possibly damaging	Het
Cacna1g	A	T	11: 94,462,261	C313S	probably damaging	Het
Camk2d	T	C	3: 126,805,858	I329T	probably benign	Het
Cavin4	A	T	4: 48,663,794	H58L	probably damaging	Het
Ccdc78	C	A	17: 25,789,065	P317T	probably benign	Het
Cdc16	T	G	8: 13,767,573	Y295D	possibly damaging	Het
Cdyl2	T	A	8: 116,594,978	N270I	probably damaging	Het
Cfap221	T	A	1: 119,984,816	I114F	possibly damaging	Het
Dmxl1	A	G	18: 49,912,766	E2414G	possibly damaging	Het
Dnah1	C	A	14: 31,300,970	R1070L	probably benign	Het
Dnah14	T	C	1: 181,666,417	S1713P	probably benign	Het
Dock10	C	A	1: 80,575,904	G602*	probably null	Het
Ep400	A	T	5: 110,756,703	V10D	possibly damaging	Het
Epas1	T	C	17: 86,829,429	C807R	probably benign	Het
Esrrb	C	T	12: 86,505,899	P200L	probably benign	Het
Fbxw26	T	C	9: 109,732,623	I168V	probably benign	Het
Fsip2	A	T	2: 82,993,768	H6615L	possibly damaging	Het
Galk2	A	T	2: 125,946,842	Q272L	possibly damaging	Het
Gas7	A	C	11: 67,629,612	T43P	probably damaging	Het
Gm5134	A	T	10: 75,995,839	I371F	probably damaging	Het
Gpr31b	C	T	17: 13,051,379	R301Q	possibly damaging	Het
Grk1	T	A	8: 13,405,765	Y216*	probably null	Het
Grm5	T	A	7: 88,026,601	M441K	probably damaging	Het
Heatr6	A	G	11: 83,766,136	E408G	probably damaging	Het
Hoxc9	G	T	15: 102,983,959	K201N	probably damaging	Het
Igsf10	T	A	3: 59,331,656	Y368F	possibly damaging	Het
Il2ra	A	T	2: 11,680,246	D131V	probably damaging	Het
Imp4	A	G	1: 34,440,096	E19G	probably benign	Het
Kcnk18	T	C	19: 59,235,607	*395Q	probably null	Het
Kdm6b	A	T	11: 69,405,026	L805Q	unknown	Het
Myt1l	G	A	12: 29,832,381	S525N	unknown	Het
Nasp	G	A	4: 116,611,077	T237I	probably benign	Het
Nell2	G	T	15: 95,473,561	Q98K	probably damaging	Het
Nfasc	C	T	1: 132,634,717	G107R	probably damaging	Het
Nsun4	A	G	4: 116,040,206	S203P	probably damaging	Het
Olfr24	T	G	9: 18,755,569	D22A	probably benign	Het
Olfr855	T	C	9: 19,584,888	V117A	probably benign	Het
Otogl	G	A	10: 107,777,117		silent	Het
Pde10a	T	C	17: 8,929,117	V366A	probably damaging	Het
Pdxk	T	A	10: 78,443,791	D250V	probably benign	Het
Pih1d1	T	A	7: 45,159,044	I179N	probably damaging	Het
Plaa	T	A	4: 94,583,992	I294F	probably damaging	Het
Pmel	C	A	10: 128,715,935	P213T	probably damaging	Het
Pom121l2	A	T	13: 21,982,302	R248*	probably null	Het
Pou2f1	T	C	1: 165,875,433		probably benign	Het
Ppm1j	G	A	3: 104,781,379	R98H	probably damaging	Het
Prkdc	C	T	16: 15,772,073	P2600L	probably damaging	Het
Prom1	T	C	5: 44,029,649	N422S	probably benign	Het
Pspn	C	T	17: 56,999,467	C154Y	probably damaging	Het
Ptdss1	T	C	13: 66,972,637		probably null	Het
Rapgef1	A	G	2: 29,736,666	Y993C	probably damaging	Het
Scrn2	A	C	11: 97,032,853	T219P	probably benign	Het
Sec23ip	T	G	7: 128,778,484	S874R	probably damaging	Het
Sept4	G	A	11: 87,585,246		probably null	Het
Slc15a3	C	T	19: 10,857,251	L499F	probably damaging	Het
Spaca9	G	A	2: 28,693,781	R64W	probably damaging	Het
Sra1	A	G	18: 36,667,575	M193T	probably damaging	Het
Srsf4	G	T	4: 131,900,294		probably benign	Het
Syne1	T	C	10: 5,052,750	D8055G	probably damaging	Het
Syne4	T	A	7: 30,316,563		probably null	Het
Tbc1d24	C	A	17: 24,208,229	G253V	probably damaging	Het
Tbck	T	A	3: 132,732,215	I467N	probably damaging	Het
Tln1	T	A	4: 43,538,030	M1857L	possibly damaging	Het
Ttll2	T	C	17: 7,351,632	R299G	probably benign	Het
Ugt2b36	T	G	5: 87,066,213	E524A	probably benign	Het
Vmn2r124	C	T	17: 18,062,851	T269I	probably benign	Het
Vmn2r4	A	G	3: 64,406,943	F206L	probably benign	Het
Zfp346	A	G	13: 55,115,574	K156R	probably damaging	Het

Other mutations in Lgr4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02043:Lgr4	APN	2	110011290	missense	probably damaging	1.00
IGL02247:Lgr4	APN	2	110002501	missense	probably benign
IGL02247:Lgr4	APN	2	110008075	splice site	probably benign
IGL02302:Lgr4	APN	2	110002496	missense	probably damaging	0.99
IGL02309:Lgr4	APN	2	110012535	utr 3 prime	probably benign
IGL02511:Lgr4	APN	2	110011272	missense	probably benign	0.06
IGL02604:Lgr4	APN	2	110011313	missense	probably damaging	1.00
IGL02648:Lgr4	APN	2	110012373	missense	probably damaging	1.00
IGL02795:Lgr4	APN	2	110008210	splice site	probably benign
IGL02899:Lgr4	APN	2	109918253	missense	probably damaging	0.99
R0003:Lgr4	UTSW	2	109997665	critical splice donor site	probably null
R0200:Lgr4	UTSW	2	109970690	critical splice acceptor site	probably null
R0314:Lgr4	UTSW	2	109991093	splice site	probably benign
R0482:Lgr4	UTSW	2	110008092	missense	probably damaging	1.00
R0491:Lgr4	UTSW	2	110007281	splice site	probably benign
R0517:Lgr4	UTSW	2	110011320	missense	probably damaging	1.00
R0546:Lgr4	UTSW	2	109999421	missense	probably damaging	0.98
R0658:Lgr4	UTSW	2	110011787	missense	possibly damaging	0.83
R1367:Lgr4	UTSW	2	109991135	missense	probably damaging	0.98
R1864:Lgr4	UTSW	2	110011397	missense	possibly damaging	0.93
R1977:Lgr4	UTSW	2	110011928	missense	probably damaging	1.00
R2239:Lgr4	UTSW	2	110012393	missense	probably damaging	1.00
R2380:Lgr4	UTSW	2	110012393	missense	probably damaging	1.00
R2383:Lgr4	UTSW	2	110000615	missense	probably damaging	1.00
R2997:Lgr4	UTSW	2	110003517	missense	probably benign	0.30
R3707:Lgr4	UTSW	2	109970754	missense	probably damaging	0.99
R3803:Lgr4	UTSW	2	110008197	missense	probably benign	0.10
R3804:Lgr4	UTSW	2	110008197	missense	probably benign	0.10
R3843:Lgr4	UTSW	2	109996773	splice site	probably benign
R4030:Lgr4	UTSW	2	109989751	missense	probably benign	0.06
R4513:Lgr4	UTSW	2	110012016	missense	possibly damaging	0.93
R4777:Lgr4	UTSW	2	109996682	missense	probably damaging	0.98
R4912:Lgr4	UTSW	2	110006502	critical splice acceptor site	probably null
R4994:Lgr4	UTSW	2	110011938	missense	probably damaging	0.99
R5106:Lgr4	UTSW	2	109997595	missense	probably damaging	0.97
R5131:Lgr4	UTSW	2	110012333	missense	probably benign
R5152:Lgr4	UTSW	2	110000603	missense	probably damaging	1.00
R5753:Lgr4	UTSW	2	110002512	nonsense	probably null
R5860:Lgr4	UTSW	2	109991151	missense	probably damaging	0.96
R5914:Lgr4	UTSW	2	109918272	missense	possibly damaging	0.78
R6263:Lgr4	UTSW	2	110011898	missense	possibly damaging	0.95
R6400:Lgr4	UTSW	2	109991133	missense	probably damaging	0.98
R6924:Lgr4	UTSW	2	110012439	missense	probably damaging	1.00
R7171:Lgr4	UTSW	2	110000969	missense	probably benign	0.11
R7326:Lgr4	UTSW	2	109996629	nonsense	probably null
R7593:Lgr4	UTSW	2	109999456	missense	probably damaging	1.00
R7659:Lgr4	UTSW	2	109996766	missense	probably damaging	1.00
R7707:Lgr4	UTSW	2	109997591	critical splice acceptor site	probably null
R7936:Lgr4	UTSW	2	110006518	missense	probably damaging	1.00
R7940:Lgr4	UTSW	2	110006513	missense	probably damaging	1.00
R8062:Lgr4	UTSW	2	110000937	missense	probably damaging	1.00
R8153:Lgr4	UTSW	2	110000300	missense	probably damaging	0.99
R9225:Lgr4	UTSW	2	110012140	missense	probably benign
R9434:Lgr4	UTSW	2	110006562	missense	probably benign
R9557:Lgr4	UTSW	2	109996739	missense	probably damaging	1.00
X0053:Lgr4	UTSW	2	110011437	missense	possibly damaging	0.52

Predicted Primers

PCR Primer
(F):5'- GCACCTCCATAGAGATGTTCG -3'
(R):5'- AGGACATTTCCAGTATCTTCTTGC -3'

Sequencing Primer
(F):5'- CTCCATAGAGATGTTCGCATGTGAC -3'
(R):5'- AATTCATGCTCTTGACATCTGTGG -3'

Posted On

2017-10-10