Incidental Mutation 'R6145:Igsf10'
ID488795
Institutional Source Beutler Lab
Gene Symbol Igsf10
Ensembl Gene ENSMUSG00000036334
Gene Nameimmunoglobulin superfamily, member 10
SynonymsAdlican2, CMF608, 6530405F15Rik
MMRRC Submission 044292-MU
Accession Numbers

Genbank: NM_001162884; MGI: 1923481

Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R6145 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location59316735-59344394 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59331656 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 368 (Y368F)
Ref Sequence ENSEMBL: ENSMUSP00000141391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039419] [ENSMUST00000193455] [ENSMUST00000194546]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039419
AA Change: Y368F

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037246
Gene: ENSMUSG00000036334
AA Change: Y368F

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000193455
AA Change: Y368F

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141971
Gene: ENSMUSG00000036334
AA Change: Y368F

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000194546
AA Change: Y368F

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141391
Gene: ENSMUSG00000036334
AA Change: Y368F

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 86,052,942 probably null Het
4930402H24Rik T C 2: 130,778,473 I247V probably benign Het
Abca8b A G 11: 109,973,808 V316A probably benign Het
Acad10 A T 5: 121,622,033 V999D probably damaging Het
Acot8 A G 2: 164,803,065 V66A probably benign Het
Ankrd11 T C 8: 122,892,661 H1484R probably damaging Het
Anxa6 A G 11: 54,994,904 F405S probably damaging Het
Asmt G A X: 170,674,663 V101I probably damaging Het
Atp1a2 C T 1: 172,287,238 V327I probably damaging Het
Brdt A G 5: 107,377,999 E906G possibly damaging Het
Cacna1g A T 11: 94,462,261 C313S probably damaging Het
Camk2d T C 3: 126,805,858 I329T probably benign Het
Cavin4 A T 4: 48,663,794 H58L probably damaging Het
Ccdc78 C A 17: 25,789,065 P317T probably benign Het
Cdc16 T G 8: 13,767,573 Y295D possibly damaging Het
Cdyl2 T A 8: 116,594,978 N270I probably damaging Het
Cfap221 T A 1: 119,984,816 I114F possibly damaging Het
Dmxl1 A G 18: 49,912,766 E2414G possibly damaging Het
Dnah1 C A 14: 31,300,970 R1070L probably benign Het
Dnah14 T C 1: 181,666,417 S1713P probably benign Het
Dock10 C A 1: 80,575,904 G602* probably null Het
Ep400 A T 5: 110,756,703 V10D possibly damaging Het
Epas1 T C 17: 86,829,429 C807R probably benign Het
Esrrb C T 12: 86,505,899 P200L probably benign Het
Fbxw26 T C 9: 109,732,623 I168V probably benign Het
Fsip2 A T 2: 82,993,768 H6615L possibly damaging Het
Galk2 A T 2: 125,946,842 Q272L possibly damaging Het
Gas7 A C 11: 67,629,612 T43P probably damaging Het
Gm5134 A T 10: 75,995,839 I371F probably damaging Het
Gpr31b C T 17: 13,051,379 R301Q possibly damaging Het
Grk1 T A 8: 13,405,765 Y216* probably null Het
Grm5 T A 7: 88,026,601 M441K probably damaging Het
Heatr6 A G 11: 83,766,136 E408G probably damaging Het
Hoxc9 G T 15: 102,983,959 K201N probably damaging Het
Il2ra A T 2: 11,680,246 D131V probably damaging Het
Imp4 A G 1: 34,440,096 E19G probably benign Het
Kcnk18 T C 19: 59,235,607 *395Q probably null Het
Kdm6b A T 11: 69,405,026 L805Q unknown Het
Lgr4 T A 2: 110,007,243 L427* probably null Het
Myt1l G A 12: 29,832,381 S525N unknown Het
Nasp G A 4: 116,611,077 T237I probably benign Het
Nell2 G T 15: 95,473,561 Q98K probably damaging Het
Nfasc C T 1: 132,634,717 G107R probably damaging Het
Nsun4 A G 4: 116,040,206 S203P probably damaging Het
Olfr24 T G 9: 18,755,569 D22A probably benign Het
Olfr855 T C 9: 19,584,888 V117A probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pde10a T C 17: 8,929,117 V366A probably damaging Het
Pdxk T A 10: 78,443,791 D250V probably benign Het
Pih1d1 T A 7: 45,159,044 I179N probably damaging Het
Plaa T A 4: 94,583,992 I294F probably damaging Het
Pmel C A 10: 128,715,935 P213T probably damaging Het
Pom121l2 A T 13: 21,982,302 R248* probably null Het
Pou2f1 T C 1: 165,875,433 probably benign Het
Ppm1j G A 3: 104,781,379 R98H probably damaging Het
Prkdc C T 16: 15,772,073 P2600L probably damaging Het
Prom1 T C 5: 44,029,649 N422S probably benign Het
Pspn C T 17: 56,999,467 C154Y probably damaging Het
Ptdss1 T C 13: 66,972,637 probably null Het
Rapgef1 A G 2: 29,736,666 Y993C probably damaging Het
Scrn2 A C 11: 97,032,853 T219P probably benign Het
Sec23ip T G 7: 128,778,484 S874R probably damaging Het
Sept4 G A 11: 87,585,246 probably null Het
Slc15a3 C T 19: 10,857,251 L499F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sra1 A G 18: 36,667,575 M193T probably damaging Het
Srsf4 G T 4: 131,900,294 probably benign Het
Syne1 T C 10: 5,052,750 D8055G probably damaging Het
Syne4 T A 7: 30,316,563 probably null Het
Tbc1d24 C A 17: 24,208,229 G253V probably damaging Het
Tbck T A 3: 132,732,215 I467N probably damaging Het
Tln1 T A 4: 43,538,030 M1857L possibly damaging Het
Ttll2 T C 17: 7,351,632 R299G probably benign Het
Ugt2b36 T G 5: 87,066,213 E524A probably benign Het
Vmn2r124 C T 17: 18,062,851 T269I probably benign Het
Vmn2r4 A G 3: 64,406,943 F206L probably benign Het
Zfp346 A G 13: 55,115,574 K156R probably damaging Het
Other mutations in Igsf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Igsf10 APN 3 59331539 missense probably benign 0.03
IGL00790:Igsf10 APN 3 59319517 missense probably damaging 1.00
IGL00916:Igsf10 APN 3 59331127 missense probably damaging 0.97
IGL00928:Igsf10 APN 3 59330597 missense probably benign 0.00
IGL01066:Igsf10 APN 3 59327782 critical splice donor site probably null
IGL01107:Igsf10 APN 3 59331524 missense probably damaging 1.00
IGL01420:Igsf10 APN 3 59319650 missense probably benign 0.02
IGL01533:Igsf10 APN 3 59319230 missense probably damaging 0.98
IGL01537:Igsf10 APN 3 59330031 missense probably benign 0.00
IGL01676:Igsf10 APN 3 59326011 missense probably benign 0.06
IGL01676:Igsf10 APN 3 59329335 missense probably benign 0.17
IGL01960:Igsf10 APN 3 59318737 missense probably benign 0.00
IGL02123:Igsf10 APN 3 59318660 missense probably damaging 0.97
IGL02198:Igsf10 APN 3 59325978 missense possibly damaging 0.95
IGL02268:Igsf10 APN 3 59331152 nonsense probably null
IGL02313:Igsf10 APN 3 59330690 missense probably benign 0.01
IGL02368:Igsf10 APN 3 59328231 missense probably benign
IGL02494:Igsf10 APN 3 59328006 missense probably damaging 0.98
IGL02549:Igsf10 APN 3 59329241 missense probably benign 0.03
IGL02616:Igsf10 APN 3 59318606 missense probably benign 0.06
IGL02957:Igsf10 APN 3 59330864 missense probably damaging 1.00
IGL03067:Igsf10 APN 3 59318918 missense probably benign 0.25
IGL03104:Igsf10 APN 3 59319484 missense probably damaging 1.00
IGL03124:Igsf10 APN 3 59319665 missense probably benign 0.01
IGL03212:Igsf10 APN 3 59328165 missense probably benign 0.09
IGL03347:Igsf10 APN 3 59331900 missense possibly damaging 0.94
IGL03357:Igsf10 APN 3 59336211 missense probably benign 0.35
F6893:Igsf10 UTSW 3 59331060 missense probably damaging 1.00
FR4449:Igsf10 UTSW 3 59319110 missense probably damaging 1.00
PIT1430001:Igsf10 UTSW 3 59328158 missense probably benign 0.06
PIT4402001:Igsf10 UTSW 3 59325579 missense probably benign 0.00
PIT4810001:Igsf10 UTSW 3 59318482 missense probably damaging 1.00
R0068:Igsf10 UTSW 3 59330624 missense probably damaging 0.98
R0095:Igsf10 UTSW 3 59331196 nonsense probably null
R0095:Igsf10 UTSW 3 59331196 nonsense probably null
R0112:Igsf10 UTSW 3 59326008 missense probably benign 0.00
R0141:Igsf10 UTSW 3 59330832 missense probably damaging 1.00
R0538:Igsf10 UTSW 3 59320106 missense probably damaging 0.99
R0551:Igsf10 UTSW 3 59328668 missense probably benign 0.01
R0556:Igsf10 UTSW 3 59328875 missense probably benign 0.02
R0582:Igsf10 UTSW 3 59319767 missense probably benign 0.00
R0630:Igsf10 UTSW 3 59326062 missense probably damaging 1.00
R0675:Igsf10 UTSW 3 59328594 missense probably benign 0.14
R0948:Igsf10 UTSW 3 59331104 missense probably damaging 1.00
R1252:Igsf10 UTSW 3 59331848 missense probably benign 0.03
R1412:Igsf10 UTSW 3 59327775 splice site probably benign
R1473:Igsf10 UTSW 3 59318767 missense probably damaging 1.00
R1585:Igsf10 UTSW 3 59330417 missense probably damaging 1.00
R1650:Igsf10 UTSW 3 59326162 missense probably damaging 1.00
R1660:Igsf10 UTSW 3 59331285 missense probably damaging 1.00
R1671:Igsf10 UTSW 3 59328500 nonsense probably null
R1748:Igsf10 UTSW 3 59319093 missense probably damaging 1.00
R1758:Igsf10 UTSW 3 59329196 missense probably benign 0.09
R1856:Igsf10 UTSW 3 59331272 missense possibly damaging 0.63
R1912:Igsf10 UTSW 3 59329572 missense probably benign 0.40
R2148:Igsf10 UTSW 3 59336577 missense possibly damaging 0.77
R2155:Igsf10 UTSW 3 59331680 missense probably damaging 1.00
R2509:Igsf10 UTSW 3 59331866 missense probably damaging 1.00
R2511:Igsf10 UTSW 3 59331866 missense probably damaging 1.00
R2680:Igsf10 UTSW 3 59325454 missense probably benign 0.14
R2913:Igsf10 UTSW 3 59331736 missense possibly damaging 0.70
R2927:Igsf10 UTSW 3 59329427 missense probably benign
R3547:Igsf10 UTSW 3 59330541 missense probably benign 0.02
R3547:Igsf10 UTSW 3 59336514 missense probably damaging 1.00
R3548:Igsf10 UTSW 3 59336514 missense probably damaging 1.00
R3620:Igsf10 UTSW 3 59336331 missense probably damaging 1.00
R3732:Igsf10 UTSW 3 59325714 missense probably benign 0.29
R3743:Igsf10 UTSW 3 59326125 missense possibly damaging 0.69
R3973:Igsf10 UTSW 3 59331924 missense probably damaging 1.00
R4005:Igsf10 UTSW 3 59328560 missense probably benign 0.00
R4184:Igsf10 UTSW 3 59319731 missense probably damaging 1.00
R4302:Igsf10 UTSW 3 59318750 missense probably damaging 1.00
R4404:Igsf10 UTSW 3 59329551 missense probably benign 0.04
R4575:Igsf10 UTSW 3 59330100 missense probably benign
R4676:Igsf10 UTSW 3 59325949 missense probably benign 0.23
R4700:Igsf10 UTSW 3 59320330 missense probably damaging 0.99
R4765:Igsf10 UTSW 3 59329705 missense probably benign 0.01
R4986:Igsf10 UTSW 3 59328606 missense probably benign 0.24
R5012:Igsf10 UTSW 3 59318722 missense probably damaging 1.00
R5070:Igsf10 UTSW 3 59328293 missense probably benign 0.02
R5083:Igsf10 UTSW 3 59326273 missense probably damaging 1.00
R5336:Igsf10 UTSW 3 59320132 missense probably damaging 1.00
R5462:Igsf10 UTSW 3 59325754 missense probably damaging 1.00
R5648:Igsf10 UTSW 3 59328153 missense probably benign 0.01
R5810:Igsf10 UTSW 3 59319071 missense probably damaging 1.00
R5871:Igsf10 UTSW 3 59330411 missense possibly damaging 0.83
R5880:Igsf10 UTSW 3 59330831 missense probably damaging 1.00
R5935:Igsf10 UTSW 3 59328157 missense probably benign 0.12
R5979:Igsf10 UTSW 3 59336473 missense probably damaging 1.00
R6222:Igsf10 UTSW 3 59318915 missense possibly damaging 0.90
R6224:Igsf10 UTSW 3 59325510 missense probably damaging 1.00
R6264:Igsf10 UTSW 3 59328507 missense possibly damaging 0.88
R6283:Igsf10 UTSW 3 59319449 missense probably damaging 1.00
R6336:Igsf10 UTSW 3 59330339 missense probably benign 0.00
R6490:Igsf10 UTSW 3 59329571 missense probably benign 0.06
R6785:Igsf10 UTSW 3 59319244 missense probably damaging 1.00
R6873:Igsf10 UTSW 3 59328444 missense probably benign
R6889:Igsf10 UTSW 3 59331933 missense probably benign
R7024:Igsf10 UTSW 3 59331701 missense probably benign 0.00
R7056:Igsf10 UTSW 3 59331080 missense probably damaging 1.00
R7128:Igsf10 UTSW 3 59328905 missense probably benign
R7251:Igsf10 UTSW 3 59319454 missense probably damaging 1.00
R7313:Igsf10 UTSW 3 59329416 missense probably benign 0.05
R7340:Igsf10 UTSW 3 59325768 missense probably damaging 1.00
R7447:Igsf10 UTSW 3 59331801 missense probably benign 0.39
R7506:Igsf10 UTSW 3 59319354 missense probably damaging 1.00
R7678:Igsf10 UTSW 3 59319340 missense possibly damaging 0.81
R7695:Igsf10 UTSW 3 59326191 missense probably damaging 1.00
R7709:Igsf10 UTSW 3 59331543 missense probably damaging 0.96
R7749:Igsf10 UTSW 3 59329128 missense possibly damaging 0.88
R7808:Igsf10 UTSW 3 59328068 missense probably benign 0.00
R7850:Igsf10 UTSW 3 59319632 missense probably benign 0.33
R7879:Igsf10 UTSW 3 59330724 missense probably damaging 1.00
R7886:Igsf10 UTSW 3 59328327 missense probably benign 0.01
R7891:Igsf10 UTSW 3 59328411 nonsense probably null
R7948:Igsf10 UTSW 3 59331858 missense probably benign 0.02
R8004:Igsf10 UTSW 3 59329709 missense probably benign 0.01
R8096:Igsf10 UTSW 3 59328959 missense probably damaging 0.98
R8141:Igsf10 UTSW 3 59330528 missense probably damaging 0.96
R8183:Igsf10 UTSW 3 59330615 missense probably benign 0.04
R8203:Igsf10 UTSW 3 59328833 missense probably benign 0.11
Z1088:Igsf10 UTSW 3 59329938 missense possibly damaging 0.59
Z1177:Igsf10 UTSW 3 59329605 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGTTCTGTTGAGCTGCAGG -3'
(R):5'- AGGACAATGGATCTGCCTCC -3'

Sequencing Primer
(F):5'- GTTGGAACCAAAAAGGATCTGCTTTG -3'
(R):5'- AGATTTCATAGAACCTTTTGGCTCC -3'
Posted On2017-10-10