Incidental Mutation 'R6145:Nasp'
ID488804
Institutional Source Beutler Lab
Gene Symbol Nasp
Ensembl Gene ENSMUSG00000028693
Gene Namenuclear autoantigenic sperm protein (histone-binding)
SynonymsD4Ertd767e, 5033430J04Rik, Epcs32, Nasp-T
MMRRC Submission 044292-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6145 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location116601052-116627941 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116611077 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 237 (T237I)
Ref Sequence ENSEMBL: ENSMUSP00000030456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030456] [ENSMUST00000030457] [ENSMUST00000081182]
Predicted Effect probably benign
Transcript: ENSMUST00000030456
AA Change: T237I

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030456
Gene: ENSMUSG00000028693
AA Change: T237I

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 8.51e0 SMART
low complexity region 111 126 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
low complexity region 336 352 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
low complexity region 492 503 N/A INTRINSIC
TPR 528 561 3.05e0 SMART
TPR 570 603 2.38e-2 SMART
low complexity region 620 640 N/A INTRINSIC
low complexity region 703 715 N/A INTRINSIC
low complexity region 742 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030457
SMART Domains Protein: ENSMUSP00000030457
Gene: ENSMUSG00000028693

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 8.51e0 SMART
low complexity region 111 126 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
low complexity region 167 178 N/A INTRINSIC
TPR 203 236 3.05e0 SMART
TPR 245 278 2.38e-2 SMART
low complexity region 295 315 N/A INTRINSIC
low complexity region 378 390 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081182
SMART Domains Protein: ENSMUSP00000079946
Gene: ENSMUSG00000028693

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 6.2e-2 SMART
low complexity region 84 99 N/A INTRINSIC
low complexity region 106 126 N/A INTRINSIC
low complexity region 140 151 N/A INTRINSIC
TPR 176 209 1.4e-2 SMART
TPR 218 251 1.1e-4 SMART
low complexity region 268 288 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
low complexity region 390 407 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155398
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a H1 histone binding protein that is involved in transporting histones into the nucleus of dividing cells. Multiple isoforms are encoded by transcript variants of this gene. The somatic form is expressed in all mitotic cells, is localized to the nucleus, and is coupled to the cell cycle. The testicular form is expressed in embryonic tissues, tumor cells, and the testis. In male germ cells, this protein is localized to the cytoplasm of primary spermatocytes, the nucleus of spermatids, and the periacrosomal region of mature spermatozoa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 86,052,942 probably null Het
4930402H24Rik T C 2: 130,778,473 I247V probably benign Het
Abca8b A G 11: 109,973,808 V316A probably benign Het
Acad10 A T 5: 121,622,033 V999D probably damaging Het
Acot8 A G 2: 164,803,065 V66A probably benign Het
Ankrd11 T C 8: 122,892,661 H1484R probably damaging Het
Anxa6 A G 11: 54,994,904 F405S probably damaging Het
Asmt G A X: 170,674,663 V101I probably damaging Het
Atp1a2 C T 1: 172,287,238 V327I probably damaging Het
Brdt A G 5: 107,377,999 E906G possibly damaging Het
Cacna1g A T 11: 94,462,261 C313S probably damaging Het
Camk2d T C 3: 126,805,858 I329T probably benign Het
Cavin4 A T 4: 48,663,794 H58L probably damaging Het
Ccdc78 C A 17: 25,789,065 P317T probably benign Het
Cdc16 T G 8: 13,767,573 Y295D possibly damaging Het
Cdyl2 T A 8: 116,594,978 N270I probably damaging Het
Cfap221 T A 1: 119,984,816 I114F possibly damaging Het
Dmxl1 A G 18: 49,912,766 E2414G possibly damaging Het
Dnah1 C A 14: 31,300,970 R1070L probably benign Het
Dnah14 T C 1: 181,666,417 S1713P probably benign Het
Dock10 C A 1: 80,575,904 G602* probably null Het
Ep400 A T 5: 110,756,703 V10D possibly damaging Het
Epas1 T C 17: 86,829,429 C807R probably benign Het
Esrrb C T 12: 86,505,899 P200L probably benign Het
Fbxw26 T C 9: 109,732,623 I168V probably benign Het
Fsip2 A T 2: 82,993,768 H6615L possibly damaging Het
Galk2 A T 2: 125,946,842 Q272L possibly damaging Het
Gas7 A C 11: 67,629,612 T43P probably damaging Het
Gm5134 A T 10: 75,995,839 I371F probably damaging Het
Gpr31b C T 17: 13,051,379 R301Q possibly damaging Het
Grk1 T A 8: 13,405,765 Y216* probably null Het
Grm5 T A 7: 88,026,601 M441K probably damaging Het
Heatr6 A G 11: 83,766,136 E408G probably damaging Het
Hoxc9 G T 15: 102,983,959 K201N probably damaging Het
Igsf10 T A 3: 59,331,656 Y368F possibly damaging Het
Il2ra A T 2: 11,680,246 D131V probably damaging Het
Imp4 A G 1: 34,440,096 E19G probably benign Het
Kcnk18 T C 19: 59,235,607 *395Q probably null Het
Kdm6b A T 11: 69,405,026 L805Q unknown Het
Lgr4 T A 2: 110,007,243 L427* probably null Het
Myt1l G A 12: 29,832,381 S525N unknown Het
Nell2 G T 15: 95,473,561 Q98K probably damaging Het
Nfasc C T 1: 132,634,717 G107R probably damaging Het
Nsun4 A G 4: 116,040,206 S203P probably damaging Het
Olfr24 T G 9: 18,755,569 D22A probably benign Het
Olfr855 T C 9: 19,584,888 V117A probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pde10a T C 17: 8,929,117 V366A probably damaging Het
Pdxk T A 10: 78,443,791 D250V probably benign Het
Pih1d1 T A 7: 45,159,044 I179N probably damaging Het
Plaa T A 4: 94,583,992 I294F probably damaging Het
Pmel C A 10: 128,715,935 P213T probably damaging Het
Pom121l2 A T 13: 21,982,302 R248* probably null Het
Pou2f1 T C 1: 165,875,433 probably benign Het
Ppm1j G A 3: 104,781,379 R98H probably damaging Het
Prkdc C T 16: 15,772,073 P2600L probably damaging Het
Prom1 T C 5: 44,029,649 N422S probably benign Het
Pspn C T 17: 56,999,467 C154Y probably damaging Het
Ptdss1 T C 13: 66,972,637 probably null Het
Rapgef1 A G 2: 29,736,666 Y993C probably damaging Het
Scrn2 A C 11: 97,032,853 T219P probably benign Het
Sec23ip T G 7: 128,778,484 S874R probably damaging Het
Sept4 G A 11: 87,585,246 probably null Het
Slc15a3 C T 19: 10,857,251 L499F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sra1 A G 18: 36,667,575 M193T probably damaging Het
Srsf4 G T 4: 131,900,294 probably benign Het
Syne1 T C 10: 5,052,750 D8055G probably damaging Het
Syne4 T A 7: 30,316,563 probably null Het
Tbc1d24 C A 17: 24,208,229 G253V probably damaging Het
Tbck T A 3: 132,732,215 I467N probably damaging Het
Tln1 T A 4: 43,538,030 M1857L possibly damaging Het
Ttll2 T C 17: 7,351,632 R299G probably benign Het
Ugt2b36 T G 5: 87,066,213 E524A probably benign Het
Vmn2r124 C T 17: 18,062,851 T269I probably benign Het
Vmn2r4 A G 3: 64,406,943 F206L probably benign Het
Zfp346 A G 13: 55,115,574 K156R probably damaging Het
Other mutations in Nasp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Nasp APN 4 116604219 missense probably damaging 1.00
IGL00780:Nasp APN 4 116603999 nonsense probably null
IGL00833:Nasp APN 4 116602736 missense probably damaging 1.00
IGL02232:Nasp APN 4 116604800 missense probably damaging 0.99
R0023:Nasp UTSW 4 116605771 splice site probably benign
R0023:Nasp UTSW 4 116605771 splice site probably benign
R0179:Nasp UTSW 4 116602157 missense probably damaging 1.00
R0385:Nasp UTSW 4 116610695 missense probably benign 0.02
R1707:Nasp UTSW 4 116618936 missense probably damaging 0.99
R1945:Nasp UTSW 4 116622768 missense possibly damaging 0.62
R2061:Nasp UTSW 4 116611126 missense probably benign 0.12
R4983:Nasp UTSW 4 116602185 missense probably damaging 0.99
R5064:Nasp UTSW 4 116611970 critical splice donor site probably null
R5687:Nasp UTSW 4 116605805 intron probably benign
R5713:Nasp UTSW 4 116614361 missense probably benign 0.34
R5839:Nasp UTSW 4 116602091 critical splice donor site probably null
R6159:Nasp UTSW 4 116603889 splice site probably null
R6234:Nasp UTSW 4 116622782 missense possibly damaging 0.51
R6286:Nasp UTSW 4 116604788 missense probably damaging 1.00
R6483:Nasp UTSW 4 116618948 missense probably damaging 1.00
R6899:Nasp UTSW 4 116604333 missense probably damaging 1.00
R7276:Nasp UTSW 4 116614349 missense probably damaging 1.00
R7412:Nasp UTSW 4 116610588 missense possibly damaging 0.85
R7763:Nasp UTSW 4 116612033 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCGCTGACTTGACTTGAGG -3'
(R):5'- GTCTCTGACAAAGCCTGAAACTG -3'

Sequencing Primer
(F):5'- ACTTGACTTGAGGGTCTATTTCAGC -3'
(R):5'- TCTGACAAAGCCTGAAACTGATAAAG -3'
Posted On2017-10-10