Incidental Mutation 'R6145:Srsf4'
ID488805
Institutional Source Beutler Lab
Gene Symbol Srsf4
Ensembl Gene ENSMUSG00000028911
Gene Nameserine/arginine-rich splicing factor 4
SynonymsMNCb-2616, Sfrs4, SRp75, 5730499P16Rik
MMRRC Submission 044292-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.307) question?
Stock #R6145 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location131873617-131901706 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 131900294 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053819] [ENSMUST00000134943]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000030743
SMART Domains Protein: ENSMUSP00000030743
Gene: ENSMUSG00000028911

DomainStartEndE-ValueType
RRM 14 73 1.09e0 SMART
low complexity region 76 102 N/A INTRINSIC
RRM 110 178 2e-14 SMART
low complexity region 184 277 N/A INTRINSIC
low complexity region 304 328 N/A INTRINSIC
low complexity region 329 408 N/A INTRINSIC
low complexity region 460 496 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000053819
AA Change: R233L
SMART Domains Protein: ENSMUSP00000061474
Gene: ENSMUSG00000028911
AA Change: R233L

DomainStartEndE-ValueType
RRM 3 68 4.3e-21 SMART
low complexity region 71 97 N/A INTRINSIC
RRM 105 173 8.4e-17 SMART
low complexity region 179 272 N/A INTRINSIC
low complexity region 299 323 N/A INTRINSIC
low complexity region 324 403 N/A INTRINSIC
low complexity region 455 490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124738
Predicted Effect probably benign
Transcript: ENSMUST00000134943
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 86,052,942 probably null Het
4930402H24Rik T C 2: 130,778,473 I247V probably benign Het
Abca8b A G 11: 109,973,808 V316A probably benign Het
Acad10 A T 5: 121,622,033 V999D probably damaging Het
Acot8 A G 2: 164,803,065 V66A probably benign Het
Ankrd11 T C 8: 122,892,661 H1484R probably damaging Het
Anxa6 A G 11: 54,994,904 F405S probably damaging Het
Asmt G A X: 170,674,663 V101I probably damaging Het
Atp1a2 C T 1: 172,287,238 V327I probably damaging Het
Brdt A G 5: 107,377,999 E906G possibly damaging Het
Cacna1g A T 11: 94,462,261 C313S probably damaging Het
Camk2d T C 3: 126,805,858 I329T probably benign Het
Cavin4 A T 4: 48,663,794 H58L probably damaging Het
Ccdc78 C A 17: 25,789,065 P317T probably benign Het
Cdc16 T G 8: 13,767,573 Y295D possibly damaging Het
Cdyl2 T A 8: 116,594,978 N270I probably damaging Het
Cfap221 T A 1: 119,984,816 I114F possibly damaging Het
Dmxl1 A G 18: 49,912,766 E2414G possibly damaging Het
Dnah1 C A 14: 31,300,970 R1070L probably benign Het
Dnah14 T C 1: 181,666,417 S1713P probably benign Het
Dock10 C A 1: 80,575,904 G602* probably null Het
Ep400 A T 5: 110,756,703 V10D possibly damaging Het
Epas1 T C 17: 86,829,429 C807R probably benign Het
Esrrb C T 12: 86,505,899 P200L probably benign Het
Fbxw26 T C 9: 109,732,623 I168V probably benign Het
Fsip2 A T 2: 82,993,768 H6615L possibly damaging Het
Galk2 A T 2: 125,946,842 Q272L possibly damaging Het
Gas7 A C 11: 67,629,612 T43P probably damaging Het
Gm5134 A T 10: 75,995,839 I371F probably damaging Het
Gpr31b C T 17: 13,051,379 R301Q possibly damaging Het
Grk1 T A 8: 13,405,765 Y216* probably null Het
Grm5 T A 7: 88,026,601 M441K probably damaging Het
Heatr6 A G 11: 83,766,136 E408G probably damaging Het
Hoxc9 G T 15: 102,983,959 K201N probably damaging Het
Igsf10 T A 3: 59,331,656 Y368F possibly damaging Het
Il2ra A T 2: 11,680,246 D131V probably damaging Het
Imp4 A G 1: 34,440,096 E19G probably benign Het
Kcnk18 T C 19: 59,235,607 *395Q probably null Het
Kdm6b A T 11: 69,405,026 L805Q unknown Het
Lgr4 T A 2: 110,007,243 L427* probably null Het
Myt1l G A 12: 29,832,381 S525N unknown Het
Nasp G A 4: 116,611,077 T237I probably benign Het
Nell2 G T 15: 95,473,561 Q98K probably damaging Het
Nfasc C T 1: 132,634,717 G107R probably damaging Het
Nsun4 A G 4: 116,040,206 S203P probably damaging Het
Olfr24 T G 9: 18,755,569 D22A probably benign Het
Olfr855 T C 9: 19,584,888 V117A probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pde10a T C 17: 8,929,117 V366A probably damaging Het
Pdxk T A 10: 78,443,791 D250V probably benign Het
Pih1d1 T A 7: 45,159,044 I179N probably damaging Het
Plaa T A 4: 94,583,992 I294F probably damaging Het
Pmel C A 10: 128,715,935 P213T probably damaging Het
Pom121l2 A T 13: 21,982,302 R248* probably null Het
Pou2f1 T C 1: 165,875,433 probably benign Het
Ppm1j G A 3: 104,781,379 R98H probably damaging Het
Prkdc C T 16: 15,772,073 P2600L probably damaging Het
Prom1 T C 5: 44,029,649 N422S probably benign Het
Pspn C T 17: 56,999,467 C154Y probably damaging Het
Ptdss1 T C 13: 66,972,637 probably null Het
Rapgef1 A G 2: 29,736,666 Y993C probably damaging Het
Scrn2 A C 11: 97,032,853 T219P probably benign Het
Sec23ip T G 7: 128,778,484 S874R probably damaging Het
Sept4 G A 11: 87,585,246 probably null Het
Slc15a3 C T 19: 10,857,251 L499F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sra1 A G 18: 36,667,575 M193T probably damaging Het
Syne1 T C 10: 5,052,750 D8055G probably damaging Het
Syne4 T A 7: 30,316,563 probably null Het
Tbc1d24 C A 17: 24,208,229 G253V probably damaging Het
Tbck T A 3: 132,732,215 I467N probably damaging Het
Tln1 T A 4: 43,538,030 M1857L possibly damaging Het
Ttll2 T C 17: 7,351,632 R299G probably benign Het
Ugt2b36 T G 5: 87,066,213 E524A probably benign Het
Vmn2r124 C T 17: 18,062,851 T269I probably benign Het
Vmn2r4 A G 3: 64,406,943 F206L probably benign Het
Zfp346 A G 13: 55,115,574 K156R probably damaging Het
Other mutations in Srsf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0087:Srsf4 UTSW 4 131900330 unclassified probably benign
R1135:Srsf4 UTSW 4 131900069 unclassified probably benign
R1209:Srsf4 UTSW 4 131901059 unclassified probably benign
R1276:Srsf4 UTSW 4 131897685 missense probably damaging 1.00
R1561:Srsf4 UTSW 4 131897695 missense probably damaging 1.00
R1574:Srsf4 UTSW 4 131897695 missense probably damaging 1.00
R1700:Srsf4 UTSW 4 131900560 unclassified probably benign
R2265:Srsf4 UTSW 4 131897682 missense probably damaging 1.00
R2269:Srsf4 UTSW 4 131897682 missense probably damaging 1.00
R3723:Srsf4 UTSW 4 131900102 unclassified probably benign
R3724:Srsf4 UTSW 4 131900102 unclassified probably benign
R3737:Srsf4 UTSW 4 131900102 unclassified probably benign
R3738:Srsf4 UTSW 4 131900102 unclassified probably benign
R3739:Srsf4 UTSW 4 131900102 unclassified probably benign
R4034:Srsf4 UTSW 4 131900102 unclassified probably benign
R4035:Srsf4 UTSW 4 131900102 unclassified probably benign
R4049:Srsf4 UTSW 4 131900543 unclassified probably benign
R4535:Srsf4 UTSW 4 131873864 missense probably damaging 1.00
R4810:Srsf4 UTSW 4 131900102 unclassified probably benign
R4833:Srsf4 UTSW 4 131900102 unclassified probably benign
R4932:Srsf4 UTSW 4 131891245 missense probably damaging 0.99
R5291:Srsf4 UTSW 4 131886306 critical splice donor site probably benign
R5725:Srsf4 UTSW 4 131900951 unclassified probably benign
R7056:Srsf4 UTSW 4 131900693 unclassified probably benign
R7294:Srsf4 UTSW 4 131900461 missense unknown
Predicted Primers PCR Primer
(F):5'- CATTCCCGGAAGAGCAGAAG -3'
(R):5'- GACTTTTACTGTCATGGCGGC -3'

Sequencing Primer
(F):5'- TGGTAGCAGTAAAAGCAGCCATTC -3'
(R):5'- TGTCATGGCGGCTGGGG -3'
Posted On2017-10-10