Mutagenetix > Incidental Mutation

Incidental Mutation 'R6145:Grm5'

488812

Institutional Source

Beutler Lab

Gene Symbol

Grm5

Ensembl Gene

ENSMUSG00000049583

Gene Name

glutamate receptor, metabotropic 5

Synonyms

Glu5R, mGluR5, 6430542K11Rik, Gprc1e

MMRRC Submission

044292-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.238) question?

Stock #

R6145 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

87584168-88134907 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 88026601 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 441 (M441K)

Ref Sequence

ENSEMBL: ENSMUSP00000114927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107263] [ENSMUST00000125009] [ENSMUST00000155358]

AlphaFold

Q3UVX5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107263
AA Change: M441K

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000102884
Gene: ENSMUSG00000049583
AA Change: M441K

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
Pfam:ANF_receptor	67	471	5.4e-97	PFAM
Pfam:Peripla_BP_6	130	332	2.5e-14	PFAM
Pfam:NCD3G	506	557	4.5e-20	PFAM
Pfam:7tm_3	588	824	7.4e-75	PFAM
low complexity region	851	860	N/A	INTRINSIC
low complexity region	929	954	N/A	INTRINSIC
low complexity region	968	987	N/A	INTRINSIC
low complexity region	1046	1056	N/A	INTRINSIC
GluR_Homer-bdg	1121	1171	1.42e-24	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000125009
AA Change: M441K

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000118393
Gene: ENSMUSG00000049583
AA Change: M441K

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
Pfam:ANF_receptor	67	471	5.7e-101	PFAM
Pfam:Peripla_BP_6	129	327	5.4e-12	PFAM
Pfam:NCD3G	506	557	3.2e-16	PFAM
Pfam:7tm_3	590	823	3.5e-56	PFAM
low complexity region	851	860	N/A	INTRINSIC
low complexity region	929	954	N/A	INTRINSIC
low complexity region	968	987	N/A	INTRINSIC
low complexity region	1046	1056	N/A	INTRINSIC
GluR_Homer-bdg	1121	1171	1.42e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000155358
AA Change: M441K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000114927
Gene: ENSMUSG00000049583
AA Change: M441K

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
Pfam:ANF_receptor	67	471	4.1e-101	PFAM
Pfam:Peripla_BP_6	129	327	2.5e-12	PFAM
Pfam:NCD3G	506	557	9.4e-17	PFAM
Pfam:7tm_3	590	823	1.3e-56	PFAM
low complexity region	851	860	N/A	INTRINSIC
low complexity region	961	986	N/A	INTRINSIC
low complexity region	1000	1019	N/A	INTRINSIC
low complexity region	1078	1088	N/A	INTRINSIC
GluR_Homer-bdg	1153	1203	1.42e-24	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 98.0%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor 3 protein family. The encoded protein is a metabatropic glutamate receptor, whose signaling activates a phosphatidylinositol-calcium second messenger system. This protein may be involved in the regulation of neural network activity and synaptic plasticity. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. A pseudogene of this gene has been defined on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice have reduced corticostriatal long term potentiation, do not exhibit hyperactivity after cocaine consumption and do not self-administer cocaine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810459M11Rik	T	A	1: 86,052,942		probably null	Het
4930402H24Rik	T	C	2: 130,778,473	I247V	probably benign	Het
Abca8b	A	G	11: 109,973,808	V316A	probably benign	Het
Acad10	A	T	5: 121,622,033	V999D	probably damaging	Het
Acot8	A	G	2: 164,803,065	V66A	probably benign	Het
Ankrd11	T	C	8: 122,892,661	H1484R	probably damaging	Het
Anxa6	A	G	11: 54,994,904	F405S	probably damaging	Het
Asmt	G	A	X: 170,674,663	V101I	probably damaging	Het
Atp1a2	C	T	1: 172,287,238	V327I	probably damaging	Het
Brdt	A	G	5: 107,377,999	E906G	possibly damaging	Het
Cacna1g	A	T	11: 94,462,261	C313S	probably damaging	Het
Camk2d	T	C	3: 126,805,858	I329T	probably benign	Het
Cavin4	A	T	4: 48,663,794	H58L	probably damaging	Het
Ccdc78	C	A	17: 25,789,065	P317T	probably benign	Het
Cdc16	T	G	8: 13,767,573	Y295D	possibly damaging	Het
Cdyl2	T	A	8: 116,594,978	N270I	probably damaging	Het
Cfap221	T	A	1: 119,984,816	I114F	possibly damaging	Het
Dmxl1	A	G	18: 49,912,766	E2414G	possibly damaging	Het
Dnah1	C	A	14: 31,300,970	R1070L	probably benign	Het
Dnah14	T	C	1: 181,666,417	S1713P	probably benign	Het
Dock10	C	A	1: 80,575,904	G602*	probably null	Het
Ep400	A	T	5: 110,756,703	V10D	possibly damaging	Het
Epas1	T	C	17: 86,829,429	C807R	probably benign	Het
Esrrb	C	T	12: 86,505,899	P200L	probably benign	Het
Fbxw26	T	C	9: 109,732,623	I168V	probably benign	Het
Fsip2	A	T	2: 82,993,768	H6615L	possibly damaging	Het
Galk2	A	T	2: 125,946,842	Q272L	possibly damaging	Het
Gas7	A	C	11: 67,629,612	T43P	probably damaging	Het
Gm5134	A	T	10: 75,995,839	I371F	probably damaging	Het
Gpr31b	C	T	17: 13,051,379	R301Q	possibly damaging	Het
Grk1	T	A	8: 13,405,765	Y216*	probably null	Het
Heatr6	A	G	11: 83,766,136	E408G	probably damaging	Het
Hoxc9	G	T	15: 102,983,959	K201N	probably damaging	Het
Igsf10	T	A	3: 59,331,656	Y368F	possibly damaging	Het
Il2ra	A	T	2: 11,680,246	D131V	probably damaging	Het
Imp4	A	G	1: 34,440,096	E19G	probably benign	Het
Kcnk18	T	C	19: 59,235,607	*395Q	probably null	Het
Kdm6b	A	T	11: 69,405,026	L805Q	unknown	Het
Lgr4	T	A	2: 110,007,243	L427*	probably null	Het
Myt1l	G	A	12: 29,832,381	S525N	unknown	Het
Nasp	G	A	4: 116,611,077	T237I	probably benign	Het
Nell2	G	T	15: 95,473,561	Q98K	probably damaging	Het
Nfasc	C	T	1: 132,634,717	G107R	probably damaging	Het
Nsun4	A	G	4: 116,040,206	S203P	probably damaging	Het
Olfr24	T	G	9: 18,755,569	D22A	probably benign	Het
Olfr855	T	C	9: 19,584,888	V117A	probably benign	Het
Otogl	G	A	10: 107,777,117		silent	Het
Pde10a	T	C	17: 8,929,117	V366A	probably damaging	Het
Pdxk	T	A	10: 78,443,791	D250V	probably benign	Het
Pih1d1	T	A	7: 45,159,044	I179N	probably damaging	Het
Plaa	T	A	4: 94,583,992	I294F	probably damaging	Het
Pmel	C	A	10: 128,715,935	P213T	probably damaging	Het
Pom121l2	A	T	13: 21,982,302	R248*	probably null	Het
Pou2f1	T	C	1: 165,875,433		probably benign	Het
Ppm1j	G	A	3: 104,781,379	R98H	probably damaging	Het
Prkdc	C	T	16: 15,772,073	P2600L	probably damaging	Het
Prom1	T	C	5: 44,029,649	N422S	probably benign	Het
Pspn	C	T	17: 56,999,467	C154Y	probably damaging	Het
Ptdss1	T	C	13: 66,972,637		probably null	Het
Rapgef1	A	G	2: 29,736,666	Y993C	probably damaging	Het
Scrn2	A	C	11: 97,032,853	T219P	probably benign	Het
Sec23ip	T	G	7: 128,778,484	S874R	probably damaging	Het
Sept4	G	A	11: 87,585,246		probably null	Het
Slc15a3	C	T	19: 10,857,251	L499F	probably damaging	Het
Spaca9	G	A	2: 28,693,781	R64W	probably damaging	Het
Sra1	A	G	18: 36,667,575	M193T	probably damaging	Het
Srsf4	G	T	4: 131,900,294		probably benign	Het
Syne1	T	C	10: 5,052,750	D8055G	probably damaging	Het
Syne4	T	A	7: 30,316,563		probably null	Het
Tbc1d24	C	A	17: 24,208,229	G253V	probably damaging	Het
Tbck	T	A	3: 132,732,215	I467N	probably damaging	Het
Tln1	T	A	4: 43,538,030	M1857L	possibly damaging	Het
Ttll2	T	C	17: 7,351,632	R299G	probably benign	Het
Ugt2b36	T	G	5: 87,066,213	E524A	probably benign	Het
Vmn2r124	C	T	17: 18,062,851	T269I	probably benign	Het
Vmn2r4	A	G	3: 64,406,943	F206L	probably benign	Het
Zfp346	A	G	13: 55,115,574	K156R	probably damaging	Het

Other mutations in Grm5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Grm5	APN	7	88130781	missense	probably benign	0.00
IGL00970:Grm5	APN	7	87803896	missense	probably damaging	0.97
IGL01286:Grm5	APN	7	87602565	missense	probably benign	0.00
IGL01307:Grm5	APN	7	88075012	missense	probably damaging	1.00
IGL01603:Grm5	APN	7	87603178	missense	probably damaging	1.00
IGL01646:Grm5	APN	7	88040059	missense	probably damaging	1.00
IGL01705:Grm5	APN	7	88130046	missense	possibly damaging	0.59
IGL02184:Grm5	APN	7	88026442	missense	probably damaging	0.98
IGL02504:Grm5	APN	7	88130772	missense	probably benign
IGL02689:Grm5	APN	7	87602710	missense	probably damaging	1.00
IGL02725:Grm5	APN	7	88074665	missense	probably damaging	1.00
IGL02851:Grm5	APN	7	88074710	missense	probably damaging	0.98
IGL03106:Grm5	APN	7	88036070	missense	probably damaging	1.00
IGL03257:Grm5	APN	7	87602898	missense	possibly damaging	0.69
IGL03291:Grm5	APN	7	88130796	missense	probably damaging	1.00
BB004:Grm5	UTSW	7	88036174	missense	probably benign	0.16
BB014:Grm5	UTSW	7	88036174	missense	probably benign	0.16
R0078:Grm5	UTSW	7	88074977	missense	probably damaging	1.00
R0314:Grm5	UTSW	7	87602955	missense	probably damaging	0.97
R0318:Grm5	UTSW	7	87602967	missense	probably damaging	0.99
R0364:Grm5	UTSW	7	88074386	missense	probably damaging	1.00
R0380:Grm5	UTSW	7	88074376	missense	possibly damaging	0.92
R0454:Grm5	UTSW	7	88130789	missense	probably damaging	1.00
R0494:Grm5	UTSW	7	88130781	missense	probably benign	0.00
R0562:Grm5	UTSW	7	87603019	missense	probably damaging	1.00
R1695:Grm5	UTSW	7	88036103	missense	possibly damaging	0.47
R2012:Grm5	UTSW	7	88074872	missense	probably damaging	1.00
R2384:Grm5	UTSW	7	87602728	missense	probably damaging	1.00
R2510:Grm5	UTSW	7	88036091	missense	probably benign	0.21
R2870:Grm5	UTSW	7	87602722	missense	possibly damaging	0.85
R2870:Grm5	UTSW	7	87602722	missense	possibly damaging	0.85
R3861:Grm5	UTSW	7	88129994	missense	possibly damaging	0.94
R4451:Grm5	UTSW	7	88075132	critical splice donor site	probably null
R4626:Grm5	UTSW	7	88130153	missense	probably damaging	1.00
R4728:Grm5	UTSW	7	87975288	missense	probably damaging	1.00
R4914:Grm5	UTSW	7	88130129	missense	probably benign	0.00
R5122:Grm5	UTSW	7	88074820	missense	probably damaging	1.00
R5352:Grm5	UTSW	7	88074850	missense	probably damaging	1.00
R5361:Grm5	UTSW	7	88074496	missense	probably damaging	1.00
R5684:Grm5	UTSW	7	88130645	missense	probably benign
R5715:Grm5	UTSW	7	88130256	missense	probably benign	0.05
R5759:Grm5	UTSW	7	88026600	missense	probably damaging	0.96
R5844:Grm5	UTSW	7	87804024	missense	possibly damaging	0.88
R5889:Grm5	UTSW	7	87603073	missense	probably damaging	1.00
R6048:Grm5	UTSW	7	88026550	missense	probably damaging	1.00
R6232:Grm5	UTSW	7	87602430	unclassified	probably benign
R6972:Grm5	UTSW	7	87602923	missense	probably benign	0.02
R7072:Grm5	UTSW	7	88074304	missense	probably damaging	1.00
R7258:Grm5	UTSW	7	88074706	missense	probably damaging	0.96
R7316:Grm5	UTSW	7	87975265	missense	probably benign
R7434:Grm5	UTSW	7	88130474	missense	probably benign	0.10
R7521:Grm5	UTSW	7	88074272	missense	possibly damaging	0.86
R7616:Grm5	UTSW	7	88116201	missense	probably benign
R7631:Grm5	UTSW	7	87975305	missense	probably damaging	1.00
R7655:Grm5	UTSW	7	88130251	missense	probably benign	0.00
R7656:Grm5	UTSW	7	88130251	missense	probably benign	0.00
R7739:Grm5	UTSW	7	88130058	missense	possibly damaging	0.46
R7897:Grm5	UTSW	7	88130861	missense	probably benign	0.14
R7927:Grm5	UTSW	7	88036174	missense	probably benign	0.16
R7967:Grm5	UTSW	7	87975361	missense	probably damaging	0.99
R8260:Grm5	UTSW	7	88075132	critical splice donor site	probably null
R8345:Grm5	UTSW	7	88074538	missense	probably damaging	1.00
R8460:Grm5	UTSW	7	87603041	missense	probably damaging	1.00
R8473:Grm5	UTSW	7	87603070	missense	probably damaging	0.97
R8531:Grm5	UTSW	7	88130516	missense	probably benign	0.05
R8671:Grm5	UTSW	7	88116290	critical splice donor site	probably null
R8805:Grm5	UTSW	7	87803968	missense	probably damaging	1.00
R9036:Grm5	UTSW	7	88036189	missense	possibly damaging	0.94
R9106:Grm5	UTSW	7	88074539	missense	probably damaging	1.00
R9136:Grm5	UTSW	7	88040046	missense	possibly damaging	0.95
R9189:Grm5	UTSW	7	88074816	missense	probably damaging	1.00
R9196:Grm5	UTSW	7	88074310	missense	probably damaging	1.00
R9232:Grm5	UTSW	7	88074383	missense	probably damaging	1.00
R9234:Grm5	UTSW	7	88074232	missense	probably damaging	1.00
R9384:Grm5	UTSW	7	88074310	missense	probably damaging	1.00
R9424:Grm5	UTSW	7	88116276	missense	probably benign	0.00
R9531:Grm5	UTSW	7	88130867	makesense	probably null
R9631:Grm5	UTSW	7	87975352	missense	probably damaging	0.98
R9691:Grm5	UTSW	7	88074695	missense	probably damaging	1.00
Z1176:Grm5	UTSW	7	87602715	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACTCTGAGAACGCATCATGTTC -3'
(R):5'- TTTCTTGGCCACAGAGAAATGAGG -3'

Sequencing Primer
(F):5'- GAGAACGCATCATGTTCAAGATTCC -3'
(R):5'- AGAGAAATGAGGCCATCCTTATC -3'

Posted On

2017-10-10