Incidental Mutation 'R6145:Cdc16'
ID488815
Institutional Source Beutler Lab
Gene Symbol Cdc16
Ensembl Gene ENSMUSG00000038416
Gene NameCDC16 cell division cycle 16
Synonyms2810431D22Rik, 2700071J12Rik
MMRRC Submission 044292-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R6145 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location13757676-13781938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 13767573 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 295 (Y295D)
Ref Sequence ENSEMBL: ENSMUSP00000047950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043962] [ENSMUST00000130173] [ENSMUST00000134645]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043962
AA Change: Y295D

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047950
Gene: ENSMUSG00000038416
AA Change: Y295D

DomainStartEndE-ValueType
Pfam:TPR_9 11 63 1.8e-3 PFAM
Pfam:ANAPC3 15 95 3.5e-23 PFAM
TPR 130 163 1.17e1 SMART
Blast:TPR 299 333 2e-8 BLAST
Blast:TPR 334 367 1e-14 BLAST
TPR 368 401 1.48e1 SMART
Blast:TPR 402 435 7e-15 BLAST
TPR 445 478 6.68e-6 SMART
TPR 479 512 1.74e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129872
Predicted Effect probably benign
Transcript: ENSMUST00000130173
Predicted Effect probably benign
Transcript: ENSMUST00000134645
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions as a protein ubiquitin ligase and is a component of the multiprotein APC complex. The APC complex is a cyclin degradation system that governs exit from mitosis by targeting cell cycle proteins for degredation by the 26S proteasome. Each component protein of the APC complex is highly conserved among eukaryotic organisms. This protein, and other APC complex proteins, contain a tetratricopeptide repeat (TPR) domain; a protein domain that is often involved in protein-protein interactions and the assembly of multiprotein complexes. Multiple alternatively spliced transcript variants, encoding distinct proteins, have been identified. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 86,052,942 probably null Het
4930402H24Rik T C 2: 130,778,473 I247V probably benign Het
Abca8b A G 11: 109,973,808 V316A probably benign Het
Acad10 A T 5: 121,622,033 V999D probably damaging Het
Acot8 A G 2: 164,803,065 V66A probably benign Het
Ankrd11 T C 8: 122,892,661 H1484R probably damaging Het
Anxa6 A G 11: 54,994,904 F405S probably damaging Het
Asmt G A X: 170,674,663 V101I probably damaging Het
Atp1a2 C T 1: 172,287,238 V327I probably damaging Het
Brdt A G 5: 107,377,999 E906G possibly damaging Het
Cacna1g A T 11: 94,462,261 C313S probably damaging Het
Camk2d T C 3: 126,805,858 I329T probably benign Het
Cavin4 A T 4: 48,663,794 H58L probably damaging Het
Ccdc78 C A 17: 25,789,065 P317T probably benign Het
Cdyl2 T A 8: 116,594,978 N270I probably damaging Het
Cfap221 T A 1: 119,984,816 I114F possibly damaging Het
Dmxl1 A G 18: 49,912,766 E2414G possibly damaging Het
Dnah1 C A 14: 31,300,970 R1070L probably benign Het
Dnah14 T C 1: 181,666,417 S1713P probably benign Het
Dock10 C A 1: 80,575,904 G602* probably null Het
Ep400 A T 5: 110,756,703 V10D possibly damaging Het
Epas1 T C 17: 86,829,429 C807R probably benign Het
Esrrb C T 12: 86,505,899 P200L probably benign Het
Fbxw26 T C 9: 109,732,623 I168V probably benign Het
Fsip2 A T 2: 82,993,768 H6615L possibly damaging Het
Galk2 A T 2: 125,946,842 Q272L possibly damaging Het
Gas7 A C 11: 67,629,612 T43P probably damaging Het
Gm5134 A T 10: 75,995,839 I371F probably damaging Het
Gpr31b C T 17: 13,051,379 R301Q possibly damaging Het
Grk1 T A 8: 13,405,765 Y216* probably null Het
Grm5 T A 7: 88,026,601 M441K probably damaging Het
Heatr6 A G 11: 83,766,136 E408G probably damaging Het
Hoxc9 G T 15: 102,983,959 K201N probably damaging Het
Igsf10 T A 3: 59,331,656 Y368F possibly damaging Het
Il2ra A T 2: 11,680,246 D131V probably damaging Het
Imp4 A G 1: 34,440,096 E19G probably benign Het
Kcnk18 T C 19: 59,235,607 *395Q probably null Het
Kdm6b A T 11: 69,405,026 L805Q unknown Het
Lgr4 T A 2: 110,007,243 L427* probably null Het
Myt1l G A 12: 29,832,381 S525N unknown Het
Nasp G A 4: 116,611,077 T237I probably benign Het
Nell2 G T 15: 95,473,561 Q98K probably damaging Het
Nfasc C T 1: 132,634,717 G107R probably damaging Het
Nsun4 A G 4: 116,040,206 S203P probably damaging Het
Olfr24 T G 9: 18,755,569 D22A probably benign Het
Olfr855 T C 9: 19,584,888 V117A probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pde10a T C 17: 8,929,117 V366A probably damaging Het
Pdxk T A 10: 78,443,791 D250V probably benign Het
Pih1d1 T A 7: 45,159,044 I179N probably damaging Het
Plaa T A 4: 94,583,992 I294F probably damaging Het
Pmel C A 10: 128,715,935 P213T probably damaging Het
Pom121l2 A T 13: 21,982,302 R248* probably null Het
Pou2f1 T C 1: 165,875,433 probably benign Het
Ppm1j G A 3: 104,781,379 R98H probably damaging Het
Prkdc C T 16: 15,772,073 P2600L probably damaging Het
Prom1 T C 5: 44,029,649 N422S probably benign Het
Pspn C T 17: 56,999,467 C154Y probably damaging Het
Ptdss1 T C 13: 66,972,637 probably null Het
Rapgef1 A G 2: 29,736,666 Y993C probably damaging Het
Scrn2 A C 11: 97,032,853 T219P probably benign Het
Sec23ip T G 7: 128,778,484 S874R probably damaging Het
Sept4 G A 11: 87,585,246 probably null Het
Slc15a3 C T 19: 10,857,251 L499F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sra1 A G 18: 36,667,575 M193T probably damaging Het
Srsf4 G T 4: 131,900,294 probably benign Het
Syne1 T C 10: 5,052,750 D8055G probably damaging Het
Syne4 T A 7: 30,316,563 probably null Het
Tbc1d24 C A 17: 24,208,229 G253V probably damaging Het
Tbck T A 3: 132,732,215 I467N probably damaging Het
Tln1 T A 4: 43,538,030 M1857L possibly damaging Het
Ttll2 T C 17: 7,351,632 R299G probably benign Het
Ugt2b36 T G 5: 87,066,213 E524A probably benign Het
Vmn2r124 C T 17: 18,062,851 T269I probably benign Het
Vmn2r4 A G 3: 64,406,943 F206L probably benign Het
Zfp346 A G 13: 55,115,574 K156R probably damaging Het
Other mutations in Cdc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Cdc16 APN 8 13767575 nonsense probably null
IGL01109:Cdc16 APN 8 13764606 missense probably benign 0.00
IGL01475:Cdc16 APN 8 13781542 missense probably benign
IGL02729:Cdc16 APN 8 13779250 missense possibly damaging 0.93
IGL03389:Cdc16 APN 8 13759179 missense probably damaging 1.00
R0026:Cdc16 UTSW 8 13759130 splice site probably null
R0373:Cdc16 UTSW 8 13779264 missense probably benign 0.04
R0520:Cdc16 UTSW 8 13760569 critical splice donor site probably null
R0564:Cdc16 UTSW 8 13781618 missense probably damaging 1.00
R1470:Cdc16 UTSW 8 13758992 splice site probably benign
R1487:Cdc16 UTSW 8 13771445 missense probably benign 0.17
R1753:Cdc16 UTSW 8 13764688 nonsense probably null
R1883:Cdc16 UTSW 8 13775738 missense probably damaging 1.00
R3087:Cdc16 UTSW 8 13759004 missense probably damaging 0.98
R3418:Cdc16 UTSW 8 13769489 nonsense probably null
R3756:Cdc16 UTSW 8 13777609 critical splice donor site probably null
R4152:Cdc16 UTSW 8 13762857 missense probably damaging 1.00
R4842:Cdc16 UTSW 8 13781644 utr 3 prime probably benign
R5122:Cdc16 UTSW 8 13764570 missense probably damaging 1.00
R5492:Cdc16 UTSW 8 13763915 splice site probably null
R5982:Cdc16 UTSW 8 13781399 missense possibly damaging 0.73
R6154:Cdc16 UTSW 8 13768609 missense possibly damaging 0.87
R6611:Cdc16 UTSW 8 13781512 missense probably benign
R6992:Cdc16 UTSW 8 13759188 missense probably benign 0.22
R7011:Cdc16 UTSW 8 13769451 missense probably damaging 1.00
R7484:Cdc16 UTSW 8 13777605 missense probably benign 0.01
R7593:Cdc16 UTSW 8 13777605 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTAGCCAGTGTCAGTGGTG -3'
(R):5'- TGTCTCACTGCTTTAACATAGCAG -3'

Sequencing Primer
(F):5'- CAGTGTCAGTGGTGGCTGTTG -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
Posted On2017-10-10