Incidental Mutation 'R6145:Cdc16'
ID 488815
Institutional Source Beutler Lab
Gene Symbol Cdc16
Ensembl Gene ENSMUSG00000038416
Gene Name CDC16 cell division cycle 16
Synonyms 2700071J12Rik, 2810431D22Rik
MMRRC Submission 044292-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.972) question?
Stock # R6145 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 13807676-13831938 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 13817573 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 295 (Y295D)
Ref Sequence ENSEMBL: ENSMUSP00000047950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043962] [ENSMUST00000130173] [ENSMUST00000134645]
AlphaFold Q8R349
Predicted Effect possibly damaging
Transcript: ENSMUST00000043962
AA Change: Y295D

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047950
Gene: ENSMUSG00000038416
AA Change: Y295D

DomainStartEndE-ValueType
Pfam:TPR_9 11 63 1.8e-3 PFAM
Pfam:ANAPC3 15 95 3.5e-23 PFAM
TPR 130 163 1.17e1 SMART
Blast:TPR 299 333 2e-8 BLAST
Blast:TPR 334 367 1e-14 BLAST
TPR 368 401 1.48e1 SMART
Blast:TPR 402 435 7e-15 BLAST
TPR 445 478 6.68e-6 SMART
TPR 479 512 1.74e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129872
Predicted Effect probably benign
Transcript: ENSMUST00000130173
Predicted Effect probably benign
Transcript: ENSMUST00000134645
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions as a protein ubiquitin ligase and is a component of the multiprotein APC complex. The APC complex is a cyclin degradation system that governs exit from mitosis by targeting cell cycle proteins for degredation by the 26S proteasome. Each component protein of the APC complex is highly conserved among eukaryotic organisms. This protein, and other APC complex proteins, contain a tetratricopeptide repeat (TPR) domain; a protein domain that is often involved in protein-protein interactions and the assembly of multiprotein complexes. Multiple alternatively spliced transcript variants, encoding distinct proteins, have been identified. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 85,980,664 (GRCm39) probably null Het
Abca8b A G 11: 109,864,634 (GRCm39) V316A probably benign Het
Acad10 A T 5: 121,760,096 (GRCm39) V999D probably damaging Het
Acot8 A G 2: 164,644,985 (GRCm39) V66A probably benign Het
Ankrd11 T C 8: 123,619,400 (GRCm39) H1484R probably damaging Het
Anxa6 A G 11: 54,885,730 (GRCm39) F405S probably damaging Het
Asmt G A X: 169,108,398 (GRCm39) V101I probably damaging Het
Atp1a2 C T 1: 172,114,805 (GRCm39) V327I probably damaging Het
Brdt A G 5: 107,525,865 (GRCm39) E906G possibly damaging Het
Cacna1g A T 11: 94,353,087 (GRCm39) C313S probably damaging Het
Camk2d T C 3: 126,599,507 (GRCm39) I329T probably benign Het
Cavin4 A T 4: 48,663,794 (GRCm39) H58L probably damaging Het
Ccdc78 C A 17: 26,008,039 (GRCm39) P317T probably benign Het
Cdyl2 T A 8: 117,321,717 (GRCm39) N270I probably damaging Het
Cfap221 T A 1: 119,912,546 (GRCm39) I114F possibly damaging Het
Dmxl1 A G 18: 50,045,833 (GRCm39) E2414G possibly damaging Het
Dnaaf9 T C 2: 130,620,393 (GRCm39) I247V probably benign Het
Dnah1 C A 14: 31,022,927 (GRCm39) R1070L probably benign Het
Dnah14 T C 1: 181,493,982 (GRCm39) S1713P probably benign Het
Dock10 C A 1: 80,553,621 (GRCm39) G602* probably null Het
Ep400 A T 5: 110,904,569 (GRCm39) V10D possibly damaging Het
Epas1 T C 17: 87,136,857 (GRCm39) C807R probably benign Het
Esrrb C T 12: 86,552,673 (GRCm39) P200L probably benign Het
Fbxw26 T C 9: 109,561,691 (GRCm39) I168V probably benign Het
Fsip2 A T 2: 82,824,112 (GRCm39) H6615L possibly damaging Het
Galk2 A T 2: 125,788,762 (GRCm39) Q272L possibly damaging Het
Gas7 A C 11: 67,520,438 (GRCm39) T43P probably damaging Het
Gm5134 A T 10: 75,831,673 (GRCm39) I371F probably damaging Het
Gpr31b C T 17: 13,270,266 (GRCm39) R301Q possibly damaging Het
Grk1 T A 8: 13,455,765 (GRCm39) Y216* probably null Het
Grm5 T A 7: 87,675,809 (GRCm39) M441K probably damaging Het
Heatr6 A G 11: 83,656,962 (GRCm39) E408G probably damaging Het
Hoxc9 G T 15: 102,892,391 (GRCm39) K201N probably damaging Het
Igsf10 T A 3: 59,239,077 (GRCm39) Y368F possibly damaging Het
Il2ra A T 2: 11,685,057 (GRCm39) D131V probably damaging Het
Imp4 A G 1: 34,479,177 (GRCm39) E19G probably benign Het
Kcnk18 T C 19: 59,224,039 (GRCm39) *395Q probably null Het
Kdm6b A T 11: 69,295,852 (GRCm39) L805Q unknown Het
Lgr4 T A 2: 109,837,588 (GRCm39) L427* probably null Het
Myt1l G A 12: 29,882,380 (GRCm39) S525N unknown Het
Nasp G A 4: 116,468,274 (GRCm39) T237I probably benign Het
Nell2 G T 15: 95,371,442 (GRCm39) Q98K probably damaging Het
Nfasc C T 1: 132,562,455 (GRCm39) G107R probably damaging Het
Nsun4 A G 4: 115,897,403 (GRCm39) S203P probably damaging Het
Or1m1 T G 9: 18,666,865 (GRCm39) D22A probably benign Het
Or7g35 T C 9: 19,496,184 (GRCm39) V117A probably benign Het
Otogl G A 10: 107,612,978 (GRCm39) silent Het
Pde10a T C 17: 9,147,949 (GRCm39) V366A probably damaging Het
Pdxk T A 10: 78,279,625 (GRCm39) D250V probably benign Het
Pih1d1 T A 7: 44,808,468 (GRCm39) I179N probably damaging Het
Plaa T A 4: 94,472,229 (GRCm39) I294F probably damaging Het
Pmel C A 10: 128,551,804 (GRCm39) P213T probably damaging Het
Pom121l2 A T 13: 22,166,472 (GRCm39) R248* probably null Het
Pou2f1 T C 1: 165,703,002 (GRCm39) probably benign Het
Ppm1j G A 3: 104,688,695 (GRCm39) R98H probably damaging Het
Prkdc C T 16: 15,589,937 (GRCm39) P2600L probably damaging Het
Prom1 T C 5: 44,186,991 (GRCm39) N422S probably benign Het
Pspn C T 17: 57,306,467 (GRCm39) C154Y probably damaging Het
Ptdss1 T C 13: 67,120,701 (GRCm39) probably null Het
Rapgef1 A G 2: 29,626,678 (GRCm39) Y993C probably damaging Het
Scrn2 A C 11: 96,923,679 (GRCm39) T219P probably benign Het
Sec23ip T G 7: 128,380,208 (GRCm39) S874R probably damaging Het
Septin4 G A 11: 87,476,072 (GRCm39) probably null Het
Slc15a3 C T 19: 10,834,615 (GRCm39) L499F probably damaging Het
Spaca9 G A 2: 28,583,793 (GRCm39) R64W probably damaging Het
Sra1 A G 18: 36,800,628 (GRCm39) M193T probably damaging Het
Srsf4 G T 4: 131,627,605 (GRCm39) probably benign Het
Syne1 T C 10: 5,002,750 (GRCm39) D8055G probably damaging Het
Syne4 T A 7: 30,015,988 (GRCm39) probably null Het
Tbc1d24 C A 17: 24,427,203 (GRCm39) G253V probably damaging Het
Tbck T A 3: 132,437,976 (GRCm39) I467N probably damaging Het
Tln1 T A 4: 43,538,030 (GRCm39) M1857L possibly damaging Het
Ttll2 T C 17: 7,619,031 (GRCm39) R299G probably benign Het
Ugt2b36 T G 5: 87,214,072 (GRCm39) E524A probably benign Het
Vmn2r124 C T 17: 18,283,113 (GRCm39) T269I probably benign Het
Vmn2r4 A G 3: 64,314,364 (GRCm39) F206L probably benign Het
Zfp346 A G 13: 55,263,387 (GRCm39) K156R probably damaging Het
Other mutations in Cdc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Cdc16 APN 8 13,817,575 (GRCm39) nonsense probably null
IGL01109:Cdc16 APN 8 13,814,606 (GRCm39) missense probably benign 0.00
IGL01475:Cdc16 APN 8 13,831,542 (GRCm39) missense probably benign
IGL02729:Cdc16 APN 8 13,829,250 (GRCm39) missense possibly damaging 0.93
IGL03389:Cdc16 APN 8 13,809,179 (GRCm39) missense probably damaging 1.00
R0026:Cdc16 UTSW 8 13,809,130 (GRCm39) splice site probably null
R0373:Cdc16 UTSW 8 13,829,264 (GRCm39) missense probably benign 0.04
R0520:Cdc16 UTSW 8 13,810,569 (GRCm39) critical splice donor site probably null
R0564:Cdc16 UTSW 8 13,831,618 (GRCm39) missense probably damaging 1.00
R1470:Cdc16 UTSW 8 13,808,992 (GRCm39) splice site probably benign
R1487:Cdc16 UTSW 8 13,821,445 (GRCm39) missense probably benign 0.17
R1753:Cdc16 UTSW 8 13,814,688 (GRCm39) nonsense probably null
R1883:Cdc16 UTSW 8 13,825,738 (GRCm39) missense probably damaging 1.00
R3087:Cdc16 UTSW 8 13,809,004 (GRCm39) missense probably damaging 0.98
R3418:Cdc16 UTSW 8 13,819,489 (GRCm39) nonsense probably null
R3756:Cdc16 UTSW 8 13,827,609 (GRCm39) critical splice donor site probably null
R4152:Cdc16 UTSW 8 13,812,857 (GRCm39) missense probably damaging 1.00
R4842:Cdc16 UTSW 8 13,831,644 (GRCm39) utr 3 prime probably benign
R5122:Cdc16 UTSW 8 13,814,570 (GRCm39) missense probably damaging 1.00
R5492:Cdc16 UTSW 8 13,813,915 (GRCm39) splice site probably null
R5982:Cdc16 UTSW 8 13,831,399 (GRCm39) missense possibly damaging 0.73
R6154:Cdc16 UTSW 8 13,818,609 (GRCm39) missense possibly damaging 0.87
R6611:Cdc16 UTSW 8 13,831,512 (GRCm39) missense probably benign
R6992:Cdc16 UTSW 8 13,809,188 (GRCm39) missense probably benign 0.22
R7011:Cdc16 UTSW 8 13,819,451 (GRCm39) missense probably damaging 1.00
R7484:Cdc16 UTSW 8 13,827,605 (GRCm39) missense probably benign 0.01
R7593:Cdc16 UTSW 8 13,827,605 (GRCm39) missense probably benign 0.01
R7946:Cdc16 UTSW 8 13,812,882 (GRCm39) missense probably benign 0.22
R9019:Cdc16 UTSW 8 13,831,501 (GRCm39) missense probably benign
R9655:Cdc16 UTSW 8 13,809,153 (GRCm39) missense possibly damaging 0.93
R9668:Cdc16 UTSW 8 13,817,552 (GRCm39) missense possibly damaging 0.94
R9796:Cdc16 UTSW 8 13,807,693 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCTAGCCAGTGTCAGTGGTG -3'
(R):5'- TGTCTCACTGCTTTAACATAGCAG -3'

Sequencing Primer
(F):5'- CAGTGTCAGTGGTGGCTGTTG -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
Posted On 2017-10-10