Incidental Mutation 'R6145:Cdyl2'
ID 488816
Institutional Source Beutler Lab
Gene Symbol Cdyl2
Ensembl Gene ENSMUSG00000031758
Gene Name chromodomain protein, Y chromosome-like 2
Synonyms 1700029M19Rik, 4930453I21Rik
MMRRC Submission 044292-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.127) question?
Stock # R6145 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 117301139-117459730 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 117321717 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 270 (N270I)
Ref Sequence ENSEMBL: ENSMUSP00000104730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109102]
AlphaFold Q9D5D8
Predicted Effect probably damaging
Transcript: ENSMUST00000109102
AA Change: N270I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104730
Gene: ENSMUSG00000031758
AA Change: N270I

DomainStartEndE-ValueType
CHROMO 6 60 1.25e-17 SMART
Pfam:ECH_1 252 499 5e-33 PFAM
Pfam:ECH_2 258 501 1.6e-14 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 85,980,664 (GRCm39) probably null Het
Abca8b A G 11: 109,864,634 (GRCm39) V316A probably benign Het
Acad10 A T 5: 121,760,096 (GRCm39) V999D probably damaging Het
Acot8 A G 2: 164,644,985 (GRCm39) V66A probably benign Het
Ankrd11 T C 8: 123,619,400 (GRCm39) H1484R probably damaging Het
Anxa6 A G 11: 54,885,730 (GRCm39) F405S probably damaging Het
Asmt G A X: 169,108,398 (GRCm39) V101I probably damaging Het
Atp1a2 C T 1: 172,114,805 (GRCm39) V327I probably damaging Het
Brdt A G 5: 107,525,865 (GRCm39) E906G possibly damaging Het
Cacna1g A T 11: 94,353,087 (GRCm39) C313S probably damaging Het
Camk2d T C 3: 126,599,507 (GRCm39) I329T probably benign Het
Cavin4 A T 4: 48,663,794 (GRCm39) H58L probably damaging Het
Ccdc78 C A 17: 26,008,039 (GRCm39) P317T probably benign Het
Cdc16 T G 8: 13,817,573 (GRCm39) Y295D possibly damaging Het
Cfap221 T A 1: 119,912,546 (GRCm39) I114F possibly damaging Het
Dmxl1 A G 18: 50,045,833 (GRCm39) E2414G possibly damaging Het
Dnaaf9 T C 2: 130,620,393 (GRCm39) I247V probably benign Het
Dnah1 C A 14: 31,022,927 (GRCm39) R1070L probably benign Het
Dnah14 T C 1: 181,493,982 (GRCm39) S1713P probably benign Het
Dock10 C A 1: 80,553,621 (GRCm39) G602* probably null Het
Ep400 A T 5: 110,904,569 (GRCm39) V10D possibly damaging Het
Epas1 T C 17: 87,136,857 (GRCm39) C807R probably benign Het
Esrrb C T 12: 86,552,673 (GRCm39) P200L probably benign Het
Fbxw26 T C 9: 109,561,691 (GRCm39) I168V probably benign Het
Fsip2 A T 2: 82,824,112 (GRCm39) H6615L possibly damaging Het
Galk2 A T 2: 125,788,762 (GRCm39) Q272L possibly damaging Het
Gas7 A C 11: 67,520,438 (GRCm39) T43P probably damaging Het
Gm5134 A T 10: 75,831,673 (GRCm39) I371F probably damaging Het
Gpr31b C T 17: 13,270,266 (GRCm39) R301Q possibly damaging Het
Grk1 T A 8: 13,455,765 (GRCm39) Y216* probably null Het
Grm5 T A 7: 87,675,809 (GRCm39) M441K probably damaging Het
Heatr6 A G 11: 83,656,962 (GRCm39) E408G probably damaging Het
Hoxc9 G T 15: 102,892,391 (GRCm39) K201N probably damaging Het
Igsf10 T A 3: 59,239,077 (GRCm39) Y368F possibly damaging Het
Il2ra A T 2: 11,685,057 (GRCm39) D131V probably damaging Het
Imp4 A G 1: 34,479,177 (GRCm39) E19G probably benign Het
Kcnk18 T C 19: 59,224,039 (GRCm39) *395Q probably null Het
Kdm6b A T 11: 69,295,852 (GRCm39) L805Q unknown Het
Lgr4 T A 2: 109,837,588 (GRCm39) L427* probably null Het
Myt1l G A 12: 29,882,380 (GRCm39) S525N unknown Het
Nasp G A 4: 116,468,274 (GRCm39) T237I probably benign Het
Nell2 G T 15: 95,371,442 (GRCm39) Q98K probably damaging Het
Nfasc C T 1: 132,562,455 (GRCm39) G107R probably damaging Het
Nsun4 A G 4: 115,897,403 (GRCm39) S203P probably damaging Het
Or1m1 T G 9: 18,666,865 (GRCm39) D22A probably benign Het
Or7g35 T C 9: 19,496,184 (GRCm39) V117A probably benign Het
Otogl G A 10: 107,612,978 (GRCm39) silent Het
Pde10a T C 17: 9,147,949 (GRCm39) V366A probably damaging Het
Pdxk T A 10: 78,279,625 (GRCm39) D250V probably benign Het
Pih1d1 T A 7: 44,808,468 (GRCm39) I179N probably damaging Het
Plaa T A 4: 94,472,229 (GRCm39) I294F probably damaging Het
Pmel C A 10: 128,551,804 (GRCm39) P213T probably damaging Het
Pom121l2 A T 13: 22,166,472 (GRCm39) R248* probably null Het
Pou2f1 T C 1: 165,703,002 (GRCm39) probably benign Het
Ppm1j G A 3: 104,688,695 (GRCm39) R98H probably damaging Het
Prkdc C T 16: 15,589,937 (GRCm39) P2600L probably damaging Het
Prom1 T C 5: 44,186,991 (GRCm39) N422S probably benign Het
Pspn C T 17: 57,306,467 (GRCm39) C154Y probably damaging Het
Ptdss1 T C 13: 67,120,701 (GRCm39) probably null Het
Rapgef1 A G 2: 29,626,678 (GRCm39) Y993C probably damaging Het
Scrn2 A C 11: 96,923,679 (GRCm39) T219P probably benign Het
Sec23ip T G 7: 128,380,208 (GRCm39) S874R probably damaging Het
Septin4 G A 11: 87,476,072 (GRCm39) probably null Het
Slc15a3 C T 19: 10,834,615 (GRCm39) L499F probably damaging Het
Spaca9 G A 2: 28,583,793 (GRCm39) R64W probably damaging Het
Sra1 A G 18: 36,800,628 (GRCm39) M193T probably damaging Het
Srsf4 G T 4: 131,627,605 (GRCm39) probably benign Het
Syne1 T C 10: 5,002,750 (GRCm39) D8055G probably damaging Het
Syne4 T A 7: 30,015,988 (GRCm39) probably null Het
Tbc1d24 C A 17: 24,427,203 (GRCm39) G253V probably damaging Het
Tbck T A 3: 132,437,976 (GRCm39) I467N probably damaging Het
Tln1 T A 4: 43,538,030 (GRCm39) M1857L possibly damaging Het
Ttll2 T C 17: 7,619,031 (GRCm39) R299G probably benign Het
Ugt2b36 T G 5: 87,214,072 (GRCm39) E524A probably benign Het
Vmn2r124 C T 17: 18,283,113 (GRCm39) T269I probably benign Het
Vmn2r4 A G 3: 64,314,364 (GRCm39) F206L probably benign Het
Zfp346 A G 13: 55,263,387 (GRCm39) K156R probably damaging Het
Other mutations in Cdyl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Cdyl2 APN 8 117,321,928 (GRCm39) splice site probably benign
IGL01670:Cdyl2 APN 8 117,351,092 (GRCm39) missense probably damaging 1.00
IGL01964:Cdyl2 APN 8 117,350,768 (GRCm39) missense probably benign 0.00
IGL02148:Cdyl2 APN 8 117,315,983 (GRCm39) splice site probably benign
IGL02186:Cdyl2 APN 8 117,306,025 (GRCm39) missense possibly damaging 0.78
Allein UTSW 8 117,305,935 (GRCm39) missense probably damaging 1.00
R0449:Cdyl2 UTSW 8 117,309,931 (GRCm39) missense probably damaging 1.00
R0630:Cdyl2 UTSW 8 117,350,774 (GRCm39) missense probably benign 0.03
R1430:Cdyl2 UTSW 8 117,306,056 (GRCm39) splice site probably benign
R1883:Cdyl2 UTSW 8 117,321,902 (GRCm39) missense probably damaging 1.00
R2326:Cdyl2 UTSW 8 117,350,537 (GRCm39) missense probably benign
R4194:Cdyl2 UTSW 8 117,305,903 (GRCm39) splice site probably null
R4916:Cdyl2 UTSW 8 117,305,926 (GRCm39) missense probably damaging 1.00
R4977:Cdyl2 UTSW 8 117,302,008 (GRCm39) missense probably damaging 0.99
R5092:Cdyl2 UTSW 8 117,350,679 (GRCm39) missense possibly damaging 0.50
R5320:Cdyl2 UTSW 8 117,321,794 (GRCm39) nonsense probably null
R5727:Cdyl2 UTSW 8 117,309,907 (GRCm39) missense probably damaging 1.00
R5830:Cdyl2 UTSW 8 117,321,823 (GRCm39) missense probably benign 0.23
R6077:Cdyl2 UTSW 8 117,316,129 (GRCm39) missense probably damaging 1.00
R6086:Cdyl2 UTSW 8 117,316,035 (GRCm39) missense probably damaging 1.00
R6380:Cdyl2 UTSW 8 117,309,923 (GRCm39) missense probably damaging 1.00
R7152:Cdyl2 UTSW 8 117,351,066 (GRCm39) missense probably damaging 1.00
R7193:Cdyl2 UTSW 8 117,350,733 (GRCm39) missense probably benign 0.09
R7244:Cdyl2 UTSW 8 117,301,999 (GRCm39) nonsense probably null
R7394:Cdyl2 UTSW 8 117,350,790 (GRCm39) missense not run
R7457:Cdyl2 UTSW 8 117,305,935 (GRCm39) missense probably damaging 1.00
R8770:Cdyl2 UTSW 8 117,321,822 (GRCm39) missense probably damaging 1.00
R9574:Cdyl2 UTSW 8 117,350,669 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATCAATGCCAGCCTGAATGG -3'
(R):5'- TGACCAATGGAGGCCTGAAC -3'

Sequencing Primer
(F):5'- TTCAACCTGAGGGTCATGAC -3'
(R):5'- TGAACCTGCACAGCCCTG -3'
Posted On 2017-10-10