Incidental Mutation 'R6145:Ankrd11'
ID488817
Institutional Source Beutler Lab
Gene Symbol Ankrd11
Ensembl Gene ENSMUSG00000035569
Gene Nameankyrin repeat domain 11
Synonyms3010027A04Rik, Yod, 2410104C19Rik, 9530048I21Rik
MMRRC Submission 044292-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6145 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location122883822-123042277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122892661 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1484 (H1484R)
Ref Sequence ENSEMBL: ENSMUSP00000095938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098333] [ENSMUST00000098334] [ENSMUST00000127664] [ENSMUST00000172906]
Predicted Effect probably damaging
Transcript: ENSMUST00000098333
AA Change: H1484R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095938
Gene: ENSMUSG00000035569
AA Change: H1484R

DomainStartEndE-ValueType
ANK 188 217 2.58e-3 SMART
ANK 221 250 1.31e-4 SMART
ANK 254 283 5.04e-6 SMART
low complexity region 311 324 N/A INTRINSIC
low complexity region 366 377 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
low complexity region 470 487 N/A INTRINSIC
low complexity region 499 521 N/A INTRINSIC
low complexity region 534 549 N/A INTRINSIC
low complexity region 596 609 N/A INTRINSIC
low complexity region 649 669 N/A INTRINSIC
coiled coil region 786 826 N/A INTRINSIC
low complexity region 867 877 N/A INTRINSIC
low complexity region 965 984 N/A INTRINSIC
low complexity region 1040 1055 N/A INTRINSIC
low complexity region 1058 1082 N/A INTRINSIC
low complexity region 1187 1200 N/A INTRINSIC
low complexity region 1204 1227 N/A INTRINSIC
low complexity region 1268 1289 N/A INTRINSIC
low complexity region 1294 1306 N/A INTRINSIC
coiled coil region 1374 1406 N/A INTRINSIC
low complexity region 1476 1496 N/A INTRINSIC
low complexity region 1508 1523 N/A INTRINSIC
low complexity region 1526 1547 N/A INTRINSIC
coiled coil region 1598 1625 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1874 1885 N/A INTRINSIC
low complexity region 1913 1922 N/A INTRINSIC
low complexity region 1969 1979 N/A INTRINSIC
low complexity region 2035 2045 N/A INTRINSIC
low complexity region 2057 2071 N/A INTRINSIC
low complexity region 2162 2179 N/A INTRINSIC
low complexity region 2191 2209 N/A INTRINSIC
low complexity region 2224 2236 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
low complexity region 2294 2305 N/A INTRINSIC
low complexity region 2391 2409 N/A INTRINSIC
low complexity region 2445 2455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098334
AA Change: H1463R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095939
Gene: ENSMUSG00000035569
AA Change: H1463R

DomainStartEndE-ValueType
ANK 167 196 2.58e-3 SMART
ANK 200 229 1.31e-4 SMART
ANK 233 262 5.04e-6 SMART
low complexity region 290 303 N/A INTRINSIC
low complexity region 345 356 N/A INTRINSIC
low complexity region 408 419 N/A INTRINSIC
low complexity region 449 466 N/A INTRINSIC
low complexity region 478 500 N/A INTRINSIC
low complexity region 513 528 N/A INTRINSIC
low complexity region 575 588 N/A INTRINSIC
low complexity region 628 648 N/A INTRINSIC
coiled coil region 765 805 N/A INTRINSIC
low complexity region 846 856 N/A INTRINSIC
low complexity region 944 963 N/A INTRINSIC
low complexity region 1019 1034 N/A INTRINSIC
low complexity region 1037 1061 N/A INTRINSIC
low complexity region 1166 1179 N/A INTRINSIC
low complexity region 1183 1206 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1273 1285 N/A INTRINSIC
coiled coil region 1353 1385 N/A INTRINSIC
low complexity region 1455 1475 N/A INTRINSIC
low complexity region 1487 1502 N/A INTRINSIC
low complexity region 1505 1526 N/A INTRINSIC
coiled coil region 1577 1604 N/A INTRINSIC
low complexity region 1749 1760 N/A INTRINSIC
low complexity region 1853 1864 N/A INTRINSIC
low complexity region 1892 1901 N/A INTRINSIC
low complexity region 1948 1958 N/A INTRINSIC
low complexity region 2014 2024 N/A INTRINSIC
low complexity region 2036 2050 N/A INTRINSIC
low complexity region 2141 2158 N/A INTRINSIC
low complexity region 2170 2188 N/A INTRINSIC
low complexity region 2203 2215 N/A INTRINSIC
low complexity region 2229 2242 N/A INTRINSIC
low complexity region 2273 2284 N/A INTRINSIC
low complexity region 2370 2388 N/A INTRINSIC
low complexity region 2424 2434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211940
Predicted Effect probably benign
Transcript: ENSMUST00000212050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212728
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an ankryin repeat domain-containing protein. The encoded protein inhibits ligand-dependent activation of transcription. Mutations in this gene have been associated with KBG syndrome, which is characterized by macrodontia, distinctive craniofacial features, short stature, skeletal anomalies, global developmental delay, seizures and intellectual disability. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 2 and X. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele die by E9.5, are small and fail to turn. Mice heterozygous for a spontaneous allele exhibit craniofacial abnormalities, decreased weight, osteoporosis and osteopenia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 86,052,942 probably null Het
4930402H24Rik T C 2: 130,778,473 I247V probably benign Het
Abca8b A G 11: 109,973,808 V316A probably benign Het
Acad10 A T 5: 121,622,033 V999D probably damaging Het
Acot8 A G 2: 164,803,065 V66A probably benign Het
Anxa6 A G 11: 54,994,904 F405S probably damaging Het
Asmt G A X: 170,674,663 V101I probably damaging Het
Atp1a2 C T 1: 172,287,238 V327I probably damaging Het
Brdt A G 5: 107,377,999 E906G possibly damaging Het
Cacna1g A T 11: 94,462,261 C313S probably damaging Het
Camk2d T C 3: 126,805,858 I329T probably benign Het
Cavin4 A T 4: 48,663,794 H58L probably damaging Het
Ccdc78 C A 17: 25,789,065 P317T probably benign Het
Cdc16 T G 8: 13,767,573 Y295D possibly damaging Het
Cdyl2 T A 8: 116,594,978 N270I probably damaging Het
Cfap221 T A 1: 119,984,816 I114F possibly damaging Het
Dmxl1 A G 18: 49,912,766 E2414G possibly damaging Het
Dnah1 C A 14: 31,300,970 R1070L probably benign Het
Dnah14 T C 1: 181,666,417 S1713P probably benign Het
Dock10 C A 1: 80,575,904 G602* probably null Het
Ep400 A T 5: 110,756,703 V10D possibly damaging Het
Epas1 T C 17: 86,829,429 C807R probably benign Het
Esrrb C T 12: 86,505,899 P200L probably benign Het
Fbxw26 T C 9: 109,732,623 I168V probably benign Het
Fsip2 A T 2: 82,993,768 H6615L possibly damaging Het
Galk2 A T 2: 125,946,842 Q272L possibly damaging Het
Gas7 A C 11: 67,629,612 T43P probably damaging Het
Gm5134 A T 10: 75,995,839 I371F probably damaging Het
Gpr31b C T 17: 13,051,379 R301Q possibly damaging Het
Grk1 T A 8: 13,405,765 Y216* probably null Het
Grm5 T A 7: 88,026,601 M441K probably damaging Het
Heatr6 A G 11: 83,766,136 E408G probably damaging Het
Hoxc9 G T 15: 102,983,959 K201N probably damaging Het
Igsf10 T A 3: 59,331,656 Y368F possibly damaging Het
Il2ra A T 2: 11,680,246 D131V probably damaging Het
Imp4 A G 1: 34,440,096 E19G probably benign Het
Kcnk18 T C 19: 59,235,607 *395Q probably null Het
Kdm6b A T 11: 69,405,026 L805Q unknown Het
Lgr4 T A 2: 110,007,243 L427* probably null Het
Myt1l G A 12: 29,832,381 S525N unknown Het
Nasp G A 4: 116,611,077 T237I probably benign Het
Nell2 G T 15: 95,473,561 Q98K probably damaging Het
Nfasc C T 1: 132,634,717 G107R probably damaging Het
Nsun4 A G 4: 116,040,206 S203P probably damaging Het
Olfr24 T G 9: 18,755,569 D22A probably benign Het
Olfr855 T C 9: 19,584,888 V117A probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pde10a T C 17: 8,929,117 V366A probably damaging Het
Pdxk T A 10: 78,443,791 D250V probably benign Het
Pih1d1 T A 7: 45,159,044 I179N probably damaging Het
Plaa T A 4: 94,583,992 I294F probably damaging Het
Pmel C A 10: 128,715,935 P213T probably damaging Het
Pom121l2 A T 13: 21,982,302 R248* probably null Het
Pou2f1 T C 1: 165,875,433 probably benign Het
Ppm1j G A 3: 104,781,379 R98H probably damaging Het
Prkdc C T 16: 15,772,073 P2600L probably damaging Het
Prom1 T C 5: 44,029,649 N422S probably benign Het
Pspn C T 17: 56,999,467 C154Y probably damaging Het
Ptdss1 T C 13: 66,972,637 probably null Het
Rapgef1 A G 2: 29,736,666 Y993C probably damaging Het
Scrn2 A C 11: 97,032,853 T219P probably benign Het
Sec23ip T G 7: 128,778,484 S874R probably damaging Het
Sept4 G A 11: 87,585,246 probably null Het
Slc15a3 C T 19: 10,857,251 L499F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sra1 A G 18: 36,667,575 M193T probably damaging Het
Srsf4 G T 4: 131,900,294 probably benign Het
Syne1 T C 10: 5,052,750 D8055G probably damaging Het
Syne4 T A 7: 30,316,563 probably null Het
Tbc1d24 C A 17: 24,208,229 G253V probably damaging Het
Tbck T A 3: 132,732,215 I467N probably damaging Het
Tln1 T A 4: 43,538,030 M1857L possibly damaging Het
Ttll2 T C 17: 7,351,632 R299G probably benign Het
Ugt2b36 T G 5: 87,066,213 E524A probably benign Het
Vmn2r124 C T 17: 18,062,851 T269I probably benign Het
Vmn2r4 A G 3: 64,406,943 F206L probably benign Het
Zfp346 A G 13: 55,115,574 K156R probably damaging Het
Other mutations in Ankrd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Ankrd11 APN 8 122908728 missense possibly damaging 0.59
IGL00971:Ankrd11 APN 8 122895353 missense probably damaging 1.00
IGL01017:Ankrd11 APN 8 122894728 missense probably damaging 1.00
IGL01137:Ankrd11 APN 8 122884336 missense probably damaging 0.99
IGL01659:Ankrd11 APN 8 122895371 missense probably damaging 1.00
IGL01920:Ankrd11 APN 8 122915897 splice site probably benign
IGL01964:Ankrd11 APN 8 122889736 missense probably damaging 0.97
IGL02131:Ankrd11 APN 8 122894410 missense probably damaging 1.00
IGL02226:Ankrd11 APN 8 122892245 missense probably damaging 1.00
IGL02549:Ankrd11 APN 8 122891293 missense probably damaging 1.00
IGL02642:Ankrd11 APN 8 122890651 missense probably damaging 1.00
IGL02643:Ankrd11 APN 8 122892322 missense probably damaging 0.98
IGL02861:Ankrd11 APN 8 122895827 missense probably damaging 0.99
IGL03086:Ankrd11 APN 8 122894510 missense probably damaging 1.00
IGL03336:Ankrd11 APN 8 122891843 missense probably benign 0.00
anchors UTSW 8 122895770 missense probably damaging 0.99
away UTSW 8 122891953 missense probably damaging 1.00
bluebell UTSW 8 122891785 missense probably damaging 0.97
Navy UTSW 8 122908734 nonsense probably null
R0051:Ankrd11 UTSW 8 122889742 missense probably damaging 1.00
R0051:Ankrd11 UTSW 8 122889742 missense probably damaging 1.00
R0110:Ankrd11 UTSW 8 122892175 missense possibly damaging 0.95
R0281:Ankrd11 UTSW 8 122895568 missense probably benign 0.01
R0450:Ankrd11 UTSW 8 122892175 missense possibly damaging 0.95
R0481:Ankrd11 UTSW 8 122900036 missense probably damaging 1.00
R0542:Ankrd11 UTSW 8 122895770 missense probably damaging 0.99
R0606:Ankrd11 UTSW 8 122892832 missense probably benign 0.04
R0702:Ankrd11 UTSW 8 122889766 missense probably damaging 1.00
R0730:Ankrd11 UTSW 8 122891953 missense probably damaging 1.00
R0737:Ankrd11 UTSW 8 122895836 missense probably damaging 0.99
R1401:Ankrd11 UTSW 8 122893050 missense probably benign 0.23
R1464:Ankrd11 UTSW 8 122892724 missense probably damaging 1.00
R1464:Ankrd11 UTSW 8 122892724 missense probably damaging 1.00
R1470:Ankrd11 UTSW 8 122899724 missense probably damaging 0.98
R1470:Ankrd11 UTSW 8 122899724 missense probably damaging 0.98
R1641:Ankrd11 UTSW 8 122891746 missense probably benign 0.03
R1950:Ankrd11 UTSW 8 122889869 missense probably damaging 1.00
R2004:Ankrd11 UTSW 8 122902422 critical splice donor site probably null
R2401:Ankrd11 UTSW 8 122908734 nonsense probably null
R2425:Ankrd11 UTSW 8 122893163 missense possibly damaging 0.86
R2830:Ankrd11 UTSW 8 122892196 missense probably damaging 1.00
R2910:Ankrd11 UTSW 8 122908798 missense probably damaging 1.00
R2911:Ankrd11 UTSW 8 122908798 missense probably damaging 1.00
R3736:Ankrd11 UTSW 8 122891785 missense probably damaging 0.97
R3738:Ankrd11 UTSW 8 122896715 unclassified probably benign
R3739:Ankrd11 UTSW 8 122896715 unclassified probably benign
R3813:Ankrd11 UTSW 8 122891378 missense probably benign
R4012:Ankrd11 UTSW 8 122892417 missense probably damaging 0.98
R4183:Ankrd11 UTSW 8 122899676 missense possibly damaging 0.88
R4213:Ankrd11 UTSW 8 122891026 missense probably benign 0.00
R4469:Ankrd11 UTSW 8 122896587 missense probably damaging 1.00
R4482:Ankrd11 UTSW 8 122893489 missense probably damaging 1.00
R4935:Ankrd11 UTSW 8 122900183 missense probably benign 0.02
R4940:Ankrd11 UTSW 8 122889821 missense probably damaging 1.00
R5145:Ankrd11 UTSW 8 122891204 utr 3 prime probably benign
R5154:Ankrd11 UTSW 8 122893139 missense probably damaging 1.00
R5230:Ankrd11 UTSW 8 122890477 missense probably benign 0.11
R5283:Ankrd11 UTSW 8 122884182 missense probably damaging 1.00
R5377:Ankrd11 UTSW 8 122893714 unclassified probably null
R5513:Ankrd11 UTSW 8 122892520 missense probably benign 0.38
R5518:Ankrd11 UTSW 8 122890994 missense possibly damaging 0.93
R5549:Ankrd11 UTSW 8 122890378 missense probably benign 0.02
R5579:Ankrd11 UTSW 8 122884231 missense probably damaging 0.97
R5595:Ankrd11 UTSW 8 122894304 nonsense probably null
R5650:Ankrd11 UTSW 8 122887397 missense probably damaging 0.99
R5717:Ankrd11 UTSW 8 122892638 missense possibly damaging 0.92
R5753:Ankrd11 UTSW 8 122895304 missense possibly damaging 0.90
R5782:Ankrd11 UTSW 8 122900017 missense probably damaging 1.00
R5812:Ankrd11 UTSW 8 122893805 unclassified probably null
R5823:Ankrd11 UTSW 8 122895790 missense probably benign 0.12
R5900:Ankrd11 UTSW 8 122891066 missense probably benign 0.00
R5975:Ankrd11 UTSW 8 122889749 missense possibly damaging 0.93
R5979:Ankrd11 UTSW 8 122892400 missense probably damaging 1.00
R6000:Ankrd11 UTSW 8 122891195 missense possibly damaging 0.73
R6252:Ankrd11 UTSW 8 122893822 missense possibly damaging 0.87
R6302:Ankrd11 UTSW 8 122889989 missense probably benign
R6457:Ankrd11 UTSW 8 122908764 missense probably damaging 1.00
R6513:Ankrd11 UTSW 8 122890180 missense probably benign 0.02
R6582:Ankrd11 UTSW 8 122891629 missense probably benign 0.00
R6738:Ankrd11 UTSW 8 122891921 missense probably damaging 0.99
R6865:Ankrd11 UTSW 8 122894944 missense probably benign 0.41
R6913:Ankrd11 UTSW 8 122894911 missense probably benign 0.01
R7101:Ankrd11 UTSW 8 122895455 missense probably benign 0.35
R7116:Ankrd11 UTSW 8 122896130 missense probably damaging 1.00
R7477:Ankrd11 UTSW 8 122894385 missense possibly damaging 0.91
R7534:Ankrd11 UTSW 8 122894410 missense probably damaging 1.00
R7555:Ankrd11 UTSW 8 122887406 missense probably damaging 0.99
R7627:Ankrd11 UTSW 8 122890951 missense possibly damaging 0.63
R7658:Ankrd11 UTSW 8 122893664 missense probably benign
R7721:Ankrd11 UTSW 8 122894759 missense probably damaging 1.00
R7731:Ankrd11 UTSW 8 122895433 missense probably benign 0.12
R7792:Ankrd11 UTSW 8 122884231 missense probably damaging 0.97
R8022:Ankrd11 UTSW 8 122887593 missense probably damaging 1.00
R8222:Ankrd11 UTSW 8 122895608 missense probably damaging 0.98
RF019:Ankrd11 UTSW 8 122896634 missense probably damaging 1.00
Z1176:Ankrd11 UTSW 8 122895803 missense possibly damaging 0.68
Z1177:Ankrd11 UTSW 8 122900142 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAGTCTCGCTGAGTTTCAGGC -3'
(R):5'- TGCCAGCCAGTTCGAGAAAG -3'

Sequencing Primer
(F):5'- CGCTGAGTTTCAGGCTTTCC -3'
(R):5'- GACTTCCTGGATGCAGAGACTTAC -3'
Posted On2017-10-10