Mutagenetix > Incidental Mutation

Incidental Mutation 'R6145:Ankrd11'

488817

Institutional Source

Beutler Lab

Gene Symbol

Ankrd11

Ensembl Gene

ENSMUSG00000035569

Gene Name

ankyrin repeat domain 11

Synonyms

3010027A04Rik, Yod, 2410104C19Rik, 9530048I21Rik

MMRRC Submission

044292-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6145 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

122883822-123042277 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 122892661 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1484 (H1484R)

Ref Sequence

ENSEMBL: ENSMUSP00000095938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098333] [ENSMUST00000098334] [ENSMUST00000127664] [ENSMUST00000172906]

AlphaFold

E9Q4F7

Predicted Effect

probably damaging
Transcript: ENSMUST00000098333
AA Change: H1484R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000095938
Gene: ENSMUSG00000035569
AA Change: H1484R

Domain	Start	End	E-Value	Type
ANK	188	217	2.58e-3	SMART
ANK	221	250	1.31e-4	SMART
ANK	254	283	5.04e-6	SMART
low complexity region	311	324	N/A	INTRINSIC
low complexity region	366	377	N/A	INTRINSIC
low complexity region	429	440	N/A	INTRINSIC
low complexity region	470	487	N/A	INTRINSIC
low complexity region	499	521	N/A	INTRINSIC
low complexity region	534	549	N/A	INTRINSIC
low complexity region	596	609	N/A	INTRINSIC
low complexity region	649	669	N/A	INTRINSIC
coiled coil region	786	826	N/A	INTRINSIC
low complexity region	867	877	N/A	INTRINSIC
low complexity region	965	984	N/A	INTRINSIC
low complexity region	1040	1055	N/A	INTRINSIC
low complexity region	1058	1082	N/A	INTRINSIC
low complexity region	1187	1200	N/A	INTRINSIC
low complexity region	1204	1227	N/A	INTRINSIC
low complexity region	1268	1289	N/A	INTRINSIC
low complexity region	1294	1306	N/A	INTRINSIC
coiled coil region	1374	1406	N/A	INTRINSIC
low complexity region	1476	1496	N/A	INTRINSIC
low complexity region	1508	1523	N/A	INTRINSIC
low complexity region	1526	1547	N/A	INTRINSIC
coiled coil region	1598	1625	N/A	INTRINSIC
low complexity region	1770	1781	N/A	INTRINSIC
low complexity region	1874	1885	N/A	INTRINSIC
low complexity region	1913	1922	N/A	INTRINSIC
low complexity region	1969	1979	N/A	INTRINSIC
low complexity region	2035	2045	N/A	INTRINSIC
low complexity region	2057	2071	N/A	INTRINSIC
low complexity region	2162	2179	N/A	INTRINSIC
low complexity region	2191	2209	N/A	INTRINSIC
low complexity region	2224	2236	N/A	INTRINSIC
low complexity region	2250	2263	N/A	INTRINSIC
low complexity region	2294	2305	N/A	INTRINSIC
low complexity region	2391	2409	N/A	INTRINSIC
low complexity region	2445	2455	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098334
AA Change: H1463R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000095939
Gene: ENSMUSG00000035569
AA Change: H1463R

Domain	Start	End	E-Value	Type
ANK	167	196	2.58e-3	SMART
ANK	200	229	1.31e-4	SMART
ANK	233	262	5.04e-6	SMART
low complexity region	290	303	N/A	INTRINSIC
low complexity region	345	356	N/A	INTRINSIC
low complexity region	408	419	N/A	INTRINSIC
low complexity region	449	466	N/A	INTRINSIC
low complexity region	478	500	N/A	INTRINSIC
low complexity region	513	528	N/A	INTRINSIC
low complexity region	575	588	N/A	INTRINSIC
low complexity region	628	648	N/A	INTRINSIC
coiled coil region	765	805	N/A	INTRINSIC
low complexity region	846	856	N/A	INTRINSIC
low complexity region	944	963	N/A	INTRINSIC
low complexity region	1019	1034	N/A	INTRINSIC
low complexity region	1037	1061	N/A	INTRINSIC
low complexity region	1166	1179	N/A	INTRINSIC
low complexity region	1183	1206	N/A	INTRINSIC
low complexity region	1247	1268	N/A	INTRINSIC
low complexity region	1273	1285	N/A	INTRINSIC
coiled coil region	1353	1385	N/A	INTRINSIC
low complexity region	1455	1475	N/A	INTRINSIC
low complexity region	1487	1502	N/A	INTRINSIC
low complexity region	1505	1526	N/A	INTRINSIC
coiled coil region	1577	1604	N/A	INTRINSIC
low complexity region	1749	1760	N/A	INTRINSIC
low complexity region	1853	1864	N/A	INTRINSIC
low complexity region	1892	1901	N/A	INTRINSIC
low complexity region	1948	1958	N/A	INTRINSIC
low complexity region	2014	2024	N/A	INTRINSIC
low complexity region	2036	2050	N/A	INTRINSIC
low complexity region	2141	2158	N/A	INTRINSIC
low complexity region	2170	2188	N/A	INTRINSIC
low complexity region	2203	2215	N/A	INTRINSIC
low complexity region	2229	2242	N/A	INTRINSIC
low complexity region	2273	2284	N/A	INTRINSIC
low complexity region	2370	2388	N/A	INTRINSIC
low complexity region	2424	2434	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172906

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211940

Predicted Effect

probably benign
Transcript: ENSMUST00000212050

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212337

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212728

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 98.0%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an ankryin repeat domain-containing protein. The encoded protein inhibits ligand-dependent activation of transcription. Mutations in this gene have been associated with KBG syndrome, which is characterized by macrodontia, distinctive craniofacial features, short stature, skeletal anomalies, global developmental delay, seizures and intellectual disability. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 2 and X. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele die by E9.5, are small and fail to turn. Mice heterozygous for a spontaneous allele exhibit craniofacial abnormalities, decreased weight, osteoporosis and osteopenia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810459M11Rik	T	A	1: 86,052,942		probably null	Het
4930402H24Rik	T	C	2: 130,778,473	I247V	probably benign	Het
Abca8b	A	G	11: 109,973,808	V316A	probably benign	Het
Acad10	A	T	5: 121,622,033	V999D	probably damaging	Het
Acot8	A	G	2: 164,803,065	V66A	probably benign	Het
Anxa6	A	G	11: 54,994,904	F405S	probably damaging	Het
Asmt	G	A	X: 170,674,663	V101I	probably damaging	Het
Atp1a2	C	T	1: 172,287,238	V327I	probably damaging	Het
Brdt	A	G	5: 107,377,999	E906G	possibly damaging	Het
Cacna1g	A	T	11: 94,462,261	C313S	probably damaging	Het
Camk2d	T	C	3: 126,805,858	I329T	probably benign	Het
Cavin4	A	T	4: 48,663,794	H58L	probably damaging	Het
Ccdc78	C	A	17: 25,789,065	P317T	probably benign	Het
Cdc16	T	G	8: 13,767,573	Y295D	possibly damaging	Het
Cdyl2	T	A	8: 116,594,978	N270I	probably damaging	Het
Cfap221	T	A	1: 119,984,816	I114F	possibly damaging	Het
Dmxl1	A	G	18: 49,912,766	E2414G	possibly damaging	Het
Dnah1	C	A	14: 31,300,970	R1070L	probably benign	Het
Dnah14	T	C	1: 181,666,417	S1713P	probably benign	Het
Dock10	C	A	1: 80,575,904	G602*	probably null	Het
Ep400	A	T	5: 110,756,703	V10D	possibly damaging	Het
Epas1	T	C	17: 86,829,429	C807R	probably benign	Het
Esrrb	C	T	12: 86,505,899	P200L	probably benign	Het
Fbxw26	T	C	9: 109,732,623	I168V	probably benign	Het
Fsip2	A	T	2: 82,993,768	H6615L	possibly damaging	Het
Galk2	A	T	2: 125,946,842	Q272L	possibly damaging	Het
Gas7	A	C	11: 67,629,612	T43P	probably damaging	Het
Gm5134	A	T	10: 75,995,839	I371F	probably damaging	Het
Gpr31b	C	T	17: 13,051,379	R301Q	possibly damaging	Het
Grk1	T	A	8: 13,405,765	Y216*	probably null	Het
Grm5	T	A	7: 88,026,601	M441K	probably damaging	Het
Heatr6	A	G	11: 83,766,136	E408G	probably damaging	Het
Hoxc9	G	T	15: 102,983,959	K201N	probably damaging	Het
Igsf10	T	A	3: 59,331,656	Y368F	possibly damaging	Het
Il2ra	A	T	2: 11,680,246	D131V	probably damaging	Het
Imp4	A	G	1: 34,440,096	E19G	probably benign	Het
Kcnk18	T	C	19: 59,235,607	*395Q	probably null	Het
Kdm6b	A	T	11: 69,405,026	L805Q	unknown	Het
Lgr4	T	A	2: 110,007,243	L427*	probably null	Het
Myt1l	G	A	12: 29,832,381	S525N	unknown	Het
Nasp	G	A	4: 116,611,077	T237I	probably benign	Het
Nell2	G	T	15: 95,473,561	Q98K	probably damaging	Het
Nfasc	C	T	1: 132,634,717	G107R	probably damaging	Het
Nsun4	A	G	4: 116,040,206	S203P	probably damaging	Het
Olfr24	T	G	9: 18,755,569	D22A	probably benign	Het
Olfr855	T	C	9: 19,584,888	V117A	probably benign	Het
Otogl	G	A	10: 107,777,117		silent	Het
Pde10a	T	C	17: 8,929,117	V366A	probably damaging	Het
Pdxk	T	A	10: 78,443,791	D250V	probably benign	Het
Pih1d1	T	A	7: 45,159,044	I179N	probably damaging	Het
Plaa	T	A	4: 94,583,992	I294F	probably damaging	Het
Pmel	C	A	10: 128,715,935	P213T	probably damaging	Het
Pom121l2	A	T	13: 21,982,302	R248*	probably null	Het
Pou2f1	T	C	1: 165,875,433		probably benign	Het
Ppm1j	G	A	3: 104,781,379	R98H	probably damaging	Het
Prkdc	C	T	16: 15,772,073	P2600L	probably damaging	Het
Prom1	T	C	5: 44,029,649	N422S	probably benign	Het
Pspn	C	T	17: 56,999,467	C154Y	probably damaging	Het
Ptdss1	T	C	13: 66,972,637		probably null	Het
Rapgef1	A	G	2: 29,736,666	Y993C	probably damaging	Het
Scrn2	A	C	11: 97,032,853	T219P	probably benign	Het
Sec23ip	T	G	7: 128,778,484	S874R	probably damaging	Het
Sept4	G	A	11: 87,585,246		probably null	Het
Slc15a3	C	T	19: 10,857,251	L499F	probably damaging	Het
Spaca9	G	A	2: 28,693,781	R64W	probably damaging	Het
Sra1	A	G	18: 36,667,575	M193T	probably damaging	Het
Srsf4	G	T	4: 131,900,294		probably benign	Het
Syne1	T	C	10: 5,052,750	D8055G	probably damaging	Het
Syne4	T	A	7: 30,316,563		probably null	Het
Tbc1d24	C	A	17: 24,208,229	G253V	probably damaging	Het
Tbck	T	A	3: 132,732,215	I467N	probably damaging	Het
Tln1	T	A	4: 43,538,030	M1857L	possibly damaging	Het
Ttll2	T	C	17: 7,351,632	R299G	probably benign	Het
Ugt2b36	T	G	5: 87,066,213	E524A	probably benign	Het
Vmn2r124	C	T	17: 18,062,851	T269I	probably benign	Het
Vmn2r4	A	G	3: 64,406,943	F206L	probably benign	Het
Zfp346	A	G	13: 55,115,574	K156R	probably damaging	Het

Other mutations in Ankrd11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Ankrd11	APN	8	122908728	missense	possibly damaging	0.59
IGL00971:Ankrd11	APN	8	122895353	missense	probably damaging	1.00
IGL01017:Ankrd11	APN	8	122894728	missense	probably damaging	1.00
IGL01137:Ankrd11	APN	8	122884336	missense	probably damaging	0.99
IGL01659:Ankrd11	APN	8	122895371	missense	probably damaging	1.00
IGL01920:Ankrd11	APN	8	122915897	splice site	probably benign
IGL01964:Ankrd11	APN	8	122889736	missense	probably damaging	0.97
IGL02131:Ankrd11	APN	8	122894410	missense	probably damaging	1.00
IGL02226:Ankrd11	APN	8	122892245	missense	probably damaging	1.00
IGL02549:Ankrd11	APN	8	122891293	missense	probably damaging	1.00
IGL02642:Ankrd11	APN	8	122890651	missense	probably damaging	1.00
IGL02643:Ankrd11	APN	8	122892322	missense	probably damaging	0.98
IGL02861:Ankrd11	APN	8	122895827	missense	probably damaging	0.99
IGL03086:Ankrd11	APN	8	122894510	missense	probably damaging	1.00
IGL03336:Ankrd11	APN	8	122891843	missense	probably benign	0.00
anchors	UTSW	8	122895770	missense	probably damaging	0.99
away	UTSW	8	122891953	missense	probably damaging	1.00
bluebell	UTSW	8	122891785	missense	probably damaging	0.97
Navy	UTSW	8	122908734	nonsense	probably null
BB001:Ankrd11	UTSW	8	122895902	missense	possibly damaging	0.95
BB011:Ankrd11	UTSW	8	122895902	missense	possibly damaging	0.95
R0051:Ankrd11	UTSW	8	122889742	missense	probably damaging	1.00
R0051:Ankrd11	UTSW	8	122889742	missense	probably damaging	1.00
R0110:Ankrd11	UTSW	8	122892175	missense	possibly damaging	0.95
R0281:Ankrd11	UTSW	8	122895568	missense	probably benign	0.01
R0450:Ankrd11	UTSW	8	122892175	missense	possibly damaging	0.95
R0481:Ankrd11	UTSW	8	122900036	missense	probably damaging	1.00
R0542:Ankrd11	UTSW	8	122895770	missense	probably damaging	0.99
R0606:Ankrd11	UTSW	8	122892832	missense	probably benign	0.04
R0702:Ankrd11	UTSW	8	122889766	missense	probably damaging	1.00
R0730:Ankrd11	UTSW	8	122891953	missense	probably damaging	1.00
R0737:Ankrd11	UTSW	8	122895836	missense	probably damaging	0.99
R1401:Ankrd11	UTSW	8	122893050	missense	probably benign	0.23
R1464:Ankrd11	UTSW	8	122892724	missense	probably damaging	1.00
R1464:Ankrd11	UTSW	8	122892724	missense	probably damaging	1.00
R1470:Ankrd11	UTSW	8	122899724	missense	probably damaging	0.98
R1470:Ankrd11	UTSW	8	122899724	missense	probably damaging	0.98
R1641:Ankrd11	UTSW	8	122891746	missense	probably benign	0.03
R1950:Ankrd11	UTSW	8	122889869	missense	probably damaging	1.00
R2004:Ankrd11	UTSW	8	122902422	critical splice donor site	probably null
R2401:Ankrd11	UTSW	8	122908734	nonsense	probably null
R2425:Ankrd11	UTSW	8	122893163	missense	possibly damaging	0.86
R2830:Ankrd11	UTSW	8	122892196	missense	probably damaging	1.00
R2910:Ankrd11	UTSW	8	122908798	missense	probably damaging	1.00
R2911:Ankrd11	UTSW	8	122908798	missense	probably damaging	1.00
R3736:Ankrd11	UTSW	8	122891785	missense	probably damaging	0.97
R3738:Ankrd11	UTSW	8	122896715	unclassified	probably benign
R3739:Ankrd11	UTSW	8	122896715	unclassified	probably benign
R3813:Ankrd11	UTSW	8	122891378	missense	probably benign
R4012:Ankrd11	UTSW	8	122892417	missense	probably damaging	0.98
R4183:Ankrd11	UTSW	8	122899676	missense	possibly damaging	0.88
R4213:Ankrd11	UTSW	8	122891026	missense	probably benign	0.00
R4469:Ankrd11	UTSW	8	122896587	missense	probably damaging	1.00
R4482:Ankrd11	UTSW	8	122893489	missense	probably damaging	1.00
R4935:Ankrd11	UTSW	8	122900183	missense	probably benign	0.02
R4940:Ankrd11	UTSW	8	122889821	missense	probably damaging	1.00
R5145:Ankrd11	UTSW	8	122891204	utr 3 prime	probably benign
R5154:Ankrd11	UTSW	8	122893139	missense	probably damaging	1.00
R5230:Ankrd11	UTSW	8	122890477	missense	probably benign	0.11
R5283:Ankrd11	UTSW	8	122884182	missense	probably damaging	1.00
R5377:Ankrd11	UTSW	8	122893714	splice site	probably null
R5513:Ankrd11	UTSW	8	122892520	missense	probably benign	0.38
R5518:Ankrd11	UTSW	8	122890994	missense	possibly damaging	0.93
R5549:Ankrd11	UTSW	8	122890378	missense	probably benign	0.02
R5579:Ankrd11	UTSW	8	122884231	missense	probably damaging	0.97
R5595:Ankrd11	UTSW	8	122894304	nonsense	probably null
R5650:Ankrd11	UTSW	8	122887397	missense	probably damaging	0.99
R5717:Ankrd11	UTSW	8	122892638	missense	possibly damaging	0.92
R5753:Ankrd11	UTSW	8	122895304	missense	possibly damaging	0.90
R5782:Ankrd11	UTSW	8	122900017	missense	probably damaging	1.00
R5812:Ankrd11	UTSW	8	122893805	splice site	probably null
R5823:Ankrd11	UTSW	8	122895790	missense	probably benign	0.12
R5900:Ankrd11	UTSW	8	122891066	missense	probably benign	0.00
R5975:Ankrd11	UTSW	8	122889749	missense	possibly damaging	0.93
R5979:Ankrd11	UTSW	8	122892400	missense	probably damaging	1.00
R6000:Ankrd11	UTSW	8	122891195	missense	possibly damaging	0.73
R6252:Ankrd11	UTSW	8	122893822	missense	possibly damaging	0.87
R6302:Ankrd11	UTSW	8	122889989	missense	probably benign
R6457:Ankrd11	UTSW	8	122908764	missense	probably damaging	1.00
R6513:Ankrd11	UTSW	8	122890180	missense	probably benign	0.02
R6582:Ankrd11	UTSW	8	122891629	missense	probably benign	0.00
R6738:Ankrd11	UTSW	8	122891921	missense	probably damaging	0.99
R6865:Ankrd11	UTSW	8	122894944	missense	probably benign	0.41
R6913:Ankrd11	UTSW	8	122894911	missense	probably benign	0.01
R7101:Ankrd11	UTSW	8	122895455	missense	probably benign	0.35
R7116:Ankrd11	UTSW	8	122896130	missense	probably damaging	1.00
R7477:Ankrd11	UTSW	8	122894385	missense	possibly damaging	0.91
R7534:Ankrd11	UTSW	8	122894410	missense	probably damaging	1.00
R7555:Ankrd11	UTSW	8	122887406	missense	probably damaging	0.99
R7627:Ankrd11	UTSW	8	122890951	missense	possibly damaging	0.63
R7658:Ankrd11	UTSW	8	122893664	missense	probably benign
R7721:Ankrd11	UTSW	8	122894759	missense	probably damaging	1.00
R7731:Ankrd11	UTSW	8	122895433	missense	probably benign	0.12
R7792:Ankrd11	UTSW	8	122884231	missense	probably damaging	0.97
R7924:Ankrd11	UTSW	8	122895902	missense	possibly damaging	0.95
R7939:Ankrd11	UTSW	8	122891073	missense	probably damaging	1.00
R8022:Ankrd11	UTSW	8	122887593	missense	probably damaging	1.00
R8222:Ankrd11	UTSW	8	122895608	missense	probably damaging	0.98
R8362:Ankrd11	UTSW	8	122892058	missense	probably damaging	0.96
R8430:Ankrd11	UTSW	8	122893366	missense	probably benign	0.01
R8511:Ankrd11	UTSW	8	122899729	missense
R8726:Ankrd11	UTSW	8	122894026	missense	possibly damaging	0.90
R8888:Ankrd11	UTSW	8	122894275	missense	possibly damaging	0.87
R8895:Ankrd11	UTSW	8	122894275	missense	possibly damaging	0.87
R8928:Ankrd11	UTSW	8	122895979	missense	probably damaging	0.99
R8930:Ankrd11	UTSW	8	122895979	missense	probably damaging	0.99
R8931:Ankrd11	UTSW	8	122895979	missense	probably damaging	0.99
R8936:Ankrd11	UTSW	8	122895101	missense	possibly damaging	0.69
R9018:Ankrd11	UTSW	8	122895512	missense	probably damaging	1.00
R9113:Ankrd11	UTSW	8	122887333	missense	possibly damaging	0.60
R9399:Ankrd11	UTSW	8	122891440	missense	probably benign
R9644:Ankrd11	UTSW	8	122890943	missense	probably benign	0.00
R9645:Ankrd11	UTSW	8	122890943	missense	probably benign	0.00
R9647:Ankrd11	UTSW	8	122890943	missense	probably benign	0.00
R9683:Ankrd11	UTSW	8	122890943	missense	probably benign	0.00
RF019:Ankrd11	UTSW	8	122896634	missense	probably damaging	1.00
Z1176:Ankrd11	UTSW	8	122895803	missense	possibly damaging	0.68
Z1177:Ankrd11	UTSW	8	122900142	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTAGTCTCGCTGAGTTTCAGGC -3'
(R):5'- TGCCAGCCAGTTCGAGAAAG -3'

Sequencing Primer
(F):5'- CGCTGAGTTTCAGGCTTTCC -3'
(R):5'- GACTTCCTGGATGCAGAGACTTAC -3'

Posted On

2017-10-10