Incidental Mutation 'R6145:Olfr24'
ID488818
Institutional Source Beutler Lab
Gene Symbol Olfr24
Ensembl Gene ENSMUSG00000054141
Gene Nameolfactory receptor 24
SynonymsMOR132-1, GA_x6K02T2PVTD-12498544-12497603, MTPCR51
MMRRC Submission 044292-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R6145 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location18751507-18763996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 18755569 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 22 (D22A)
Ref Sequence ENSEMBL: ENSMUSP00000149702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066997] [ENSMUST00000216754]
Predicted Effect probably benign
Transcript: ENSMUST00000066997
AA Change: D22A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000064189
Gene: ENSMUSG00000054141
AA Change: D22A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-64 PFAM
Pfam:7TM_GPCR_Srsx 35 304 9.2e-9 PFAM
Pfam:7tm_1 41 290 3.2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212239
AA Change: D22A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214366
Predicted Effect probably benign
Transcript: ENSMUST00000216754
AA Change: D22A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 86,052,942 probably null Het
4930402H24Rik T C 2: 130,778,473 I247V probably benign Het
Abca8b A G 11: 109,973,808 V316A probably benign Het
Acad10 A T 5: 121,622,033 V999D probably damaging Het
Acot8 A G 2: 164,803,065 V66A probably benign Het
Ankrd11 T C 8: 122,892,661 H1484R probably damaging Het
Anxa6 A G 11: 54,994,904 F405S probably damaging Het
Asmt G A X: 170,674,663 V101I probably damaging Het
Atp1a2 C T 1: 172,287,238 V327I probably damaging Het
Brdt A G 5: 107,377,999 E906G possibly damaging Het
Cacna1g A T 11: 94,462,261 C313S probably damaging Het
Camk2d T C 3: 126,805,858 I329T probably benign Het
Cavin4 A T 4: 48,663,794 H58L probably damaging Het
Ccdc78 C A 17: 25,789,065 P317T probably benign Het
Cdc16 T G 8: 13,767,573 Y295D possibly damaging Het
Cdyl2 T A 8: 116,594,978 N270I probably damaging Het
Cfap221 T A 1: 119,984,816 I114F possibly damaging Het
Dmxl1 A G 18: 49,912,766 E2414G possibly damaging Het
Dnah1 C A 14: 31,300,970 R1070L probably benign Het
Dnah14 T C 1: 181,666,417 S1713P probably benign Het
Dock10 C A 1: 80,575,904 G602* probably null Het
Ep400 A T 5: 110,756,703 V10D possibly damaging Het
Epas1 T C 17: 86,829,429 C807R probably benign Het
Esrrb C T 12: 86,505,899 P200L probably benign Het
Fbxw26 T C 9: 109,732,623 I168V probably benign Het
Fsip2 A T 2: 82,993,768 H6615L possibly damaging Het
Galk2 A T 2: 125,946,842 Q272L possibly damaging Het
Gas7 A C 11: 67,629,612 T43P probably damaging Het
Gm5134 A T 10: 75,995,839 I371F probably damaging Het
Gpr31b C T 17: 13,051,379 R301Q possibly damaging Het
Grk1 T A 8: 13,405,765 Y216* probably null Het
Grm5 T A 7: 88,026,601 M441K probably damaging Het
Heatr6 A G 11: 83,766,136 E408G probably damaging Het
Hoxc9 G T 15: 102,983,959 K201N probably damaging Het
Igsf10 T A 3: 59,331,656 Y368F possibly damaging Het
Il2ra A T 2: 11,680,246 D131V probably damaging Het
Imp4 A G 1: 34,440,096 E19G probably benign Het
Kcnk18 T C 19: 59,235,607 *395Q probably null Het
Kdm6b A T 11: 69,405,026 L805Q unknown Het
Lgr4 T A 2: 110,007,243 L427* probably null Het
Myt1l G A 12: 29,832,381 S525N unknown Het
Nasp G A 4: 116,611,077 T237I probably benign Het
Nell2 G T 15: 95,473,561 Q98K probably damaging Het
Nfasc C T 1: 132,634,717 G107R probably damaging Het
Nsun4 A G 4: 116,040,206 S203P probably damaging Het
Olfr855 T C 9: 19,584,888 V117A probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pde10a T C 17: 8,929,117 V366A probably damaging Het
Pdxk T A 10: 78,443,791 D250V probably benign Het
Pih1d1 T A 7: 45,159,044 I179N probably damaging Het
Plaa T A 4: 94,583,992 I294F probably damaging Het
Pmel C A 10: 128,715,935 P213T probably damaging Het
Pom121l2 A T 13: 21,982,302 R248* probably null Het
Pou2f1 T C 1: 165,875,433 probably benign Het
Ppm1j G A 3: 104,781,379 R98H probably damaging Het
Prkdc C T 16: 15,772,073 P2600L probably damaging Het
Prom1 T C 5: 44,029,649 N422S probably benign Het
Pspn C T 17: 56,999,467 C154Y probably damaging Het
Ptdss1 T C 13: 66,972,637 probably null Het
Rapgef1 A G 2: 29,736,666 Y993C probably damaging Het
Scrn2 A C 11: 97,032,853 T219P probably benign Het
Sec23ip T G 7: 128,778,484 S874R probably damaging Het
Sept4 G A 11: 87,585,246 probably null Het
Slc15a3 C T 19: 10,857,251 L499F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sra1 A G 18: 36,667,575 M193T probably damaging Het
Srsf4 G T 4: 131,900,294 probably benign Het
Syne1 T C 10: 5,052,750 D8055G probably damaging Het
Syne4 T A 7: 30,316,563 probably null Het
Tbc1d24 C A 17: 24,208,229 G253V probably damaging Het
Tbck T A 3: 132,732,215 I467N probably damaging Het
Tln1 T A 4: 43,538,030 M1857L possibly damaging Het
Ttll2 T C 17: 7,351,632 R299G probably benign Het
Ugt2b36 T G 5: 87,066,213 E524A probably benign Het
Vmn2r124 C T 17: 18,062,851 T269I probably benign Het
Vmn2r4 A G 3: 64,406,943 F206L probably benign Het
Zfp346 A G 13: 55,115,574 K156R probably damaging Het
Other mutations in Olfr24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02346:Olfr24 APN 9 18754769 missense probably damaging 0.97
IGL02371:Olfr24 APN 9 18754704 missense probably benign 0.07
IGL02555:Olfr24 APN 9 18755473 missense probably benign 0.40
IGL03025:Olfr24 APN 9 18755369 missense probably benign 0.00
IGL03259:Olfr24 APN 9 18755515 missense probably benign
IGL03050:Olfr24 UTSW 9 18755454 nonsense probably null
R0310:Olfr24 UTSW 9 18755333 missense possibly damaging 0.91
R0410:Olfr24 UTSW 9 18754841 missense probably damaging 0.96
R2152:Olfr24 UTSW 9 18755095 missense probably damaging 1.00
R2153:Olfr24 UTSW 9 18755095 missense probably damaging 1.00
R2918:Olfr24 UTSW 9 18755479 missense probably damaging 1.00
R4552:Olfr24 UTSW 9 18755134 missense possibly damaging 0.60
R5073:Olfr24 UTSW 9 18754822 missense possibly damaging 0.89
R5539:Olfr24 UTSW 9 18754838 missense probably damaging 0.99
R5662:Olfr24 UTSW 9 18755600 missense probably damaging 0.99
R7125:Olfr24 UTSW 9 18754878 nonsense probably null
R7196:Olfr24 UTSW 9 18755590 nonsense probably null
R7607:Olfr24 UTSW 9 18754882 missense possibly damaging 0.93
Z1177:Olfr24 UTSW 9 18755519 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ACATCTGGGTCAGACAACAAG -3'
(R):5'- GTAATTAGCTCAGACAAGAACTGG -3'

Sequencing Primer
(F):5'- TATTCACCAGCATCTTGGGGACAG -3'
(R):5'- GAGTTAAACACATGGAACCAC -3'
Posted On2017-10-10