Incidental Mutation 'R6145:Gas7'
ID488826
Institutional Source Beutler Lab
Gene Symbol Gas7
Ensembl Gene ENSMUSG00000033066
Gene Namegrowth arrest specific 7
SynonymsB230343A10Rik, Gas7-cb
MMRRC Submission 044292-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6145 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location67455437-67688990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 67629612 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 43 (T43P)
Ref Sequence ENSEMBL: ENSMUSP00000104322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041611] [ENSMUST00000108680] [ENSMUST00000108681] [ENSMUST00000108682]
Predicted Effect probably damaging
Transcript: ENSMUST00000041611
AA Change: T39P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038420
Gene: ENSMUSG00000033066
AA Change: T39P

DomainStartEndE-ValueType
WW 14 46 1.39e-11 SMART
FCH 146 232 6.62e-25 SMART
coiled coil region 260 304 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108680
AA Change: T39P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104320
Gene: ENSMUSG00000033066
AA Change: T39P

DomainStartEndE-ValueType
WW 14 46 1.39e-11 SMART
FCH 146 232 6.62e-25 SMART
coiled coil region 260 304 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108681
AA Change: T39P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104321
Gene: ENSMUSG00000033066
AA Change: T39P

DomainStartEndE-ValueType
WW 14 46 1.39e-11 SMART
FCH 146 232 6.62e-25 SMART
coiled coil region 260 304 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108682
AA Change: T43P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104322
Gene: ENSMUSG00000033066
AA Change: T43P

DomainStartEndE-ValueType
WW 18 50 1.39e-11 SMART
FCH 150 236 6.62e-25 SMART
coiled coil region 264 308 N/A INTRINSIC
low complexity region 339 358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151784
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Growth arrest-specific 7 is expressed primarily in terminally differentiated brain cells and predominantly in mature cerebellar Purkinje neurons. GAS7 plays a putative role in neuronal development. Several transcript variants encoding proteins which vary in the N-terminus have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aged mice homozygous for a hypomorphic allele show impaired coordination, decreased grip strength, decreased motor neuron number, muscle weakness, abnormal skeletal muscle fiber type ratio in the soleus muscle, and defects in motor neuron axon terminal sprouting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 86,052,942 probably null Het
4930402H24Rik T C 2: 130,778,473 I247V probably benign Het
Abca8b A G 11: 109,973,808 V316A probably benign Het
Acad10 A T 5: 121,622,033 V999D probably damaging Het
Acot8 A G 2: 164,803,065 V66A probably benign Het
Ankrd11 T C 8: 122,892,661 H1484R probably damaging Het
Anxa6 A G 11: 54,994,904 F405S probably damaging Het
Asmt G A X: 170,674,663 V101I probably damaging Het
Atp1a2 C T 1: 172,287,238 V327I probably damaging Het
Brdt A G 5: 107,377,999 E906G possibly damaging Het
Cacna1g A T 11: 94,462,261 C313S probably damaging Het
Camk2d T C 3: 126,805,858 I329T probably benign Het
Cavin4 A T 4: 48,663,794 H58L probably damaging Het
Ccdc78 C A 17: 25,789,065 P317T probably benign Het
Cdc16 T G 8: 13,767,573 Y295D possibly damaging Het
Cdyl2 T A 8: 116,594,978 N270I probably damaging Het
Cfap221 T A 1: 119,984,816 I114F possibly damaging Het
Dmxl1 A G 18: 49,912,766 E2414G possibly damaging Het
Dnah1 C A 14: 31,300,970 R1070L probably benign Het
Dnah14 T C 1: 181,666,417 S1713P probably benign Het
Dock10 C A 1: 80,575,904 G602* probably null Het
Ep400 A T 5: 110,756,703 V10D possibly damaging Het
Epas1 T C 17: 86,829,429 C807R probably benign Het
Esrrb C T 12: 86,505,899 P200L probably benign Het
Fbxw26 T C 9: 109,732,623 I168V probably benign Het
Fsip2 A T 2: 82,993,768 H6615L possibly damaging Het
Galk2 A T 2: 125,946,842 Q272L possibly damaging Het
Gm5134 A T 10: 75,995,839 I371F probably damaging Het
Gpr31b C T 17: 13,051,379 R301Q possibly damaging Het
Grk1 T A 8: 13,405,765 Y216* probably null Het
Grm5 T A 7: 88,026,601 M441K probably damaging Het
Heatr6 A G 11: 83,766,136 E408G probably damaging Het
Hoxc9 G T 15: 102,983,959 K201N probably damaging Het
Igsf10 T A 3: 59,331,656 Y368F possibly damaging Het
Il2ra A T 2: 11,680,246 D131V probably damaging Het
Imp4 A G 1: 34,440,096 E19G probably benign Het
Kcnk18 T C 19: 59,235,607 *395Q probably null Het
Kdm6b A T 11: 69,405,026 L805Q unknown Het
Lgr4 T A 2: 110,007,243 L427* probably null Het
Myt1l G A 12: 29,832,381 S525N unknown Het
Nasp G A 4: 116,611,077 T237I probably benign Het
Nell2 G T 15: 95,473,561 Q98K probably damaging Het
Nfasc C T 1: 132,634,717 G107R probably damaging Het
Nsun4 A G 4: 116,040,206 S203P probably damaging Het
Olfr24 T G 9: 18,755,569 D22A probably benign Het
Olfr855 T C 9: 19,584,888 V117A probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pde10a T C 17: 8,929,117 V366A probably damaging Het
Pdxk T A 10: 78,443,791 D250V probably benign Het
Pih1d1 T A 7: 45,159,044 I179N probably damaging Het
Plaa T A 4: 94,583,992 I294F probably damaging Het
Pmel C A 10: 128,715,935 P213T probably damaging Het
Pom121l2 A T 13: 21,982,302 R248* probably null Het
Pou2f1 T C 1: 165,875,433 probably benign Het
Ppm1j G A 3: 104,781,379 R98H probably damaging Het
Prkdc C T 16: 15,772,073 P2600L probably damaging Het
Prom1 T C 5: 44,029,649 N422S probably benign Het
Pspn C T 17: 56,999,467 C154Y probably damaging Het
Ptdss1 T C 13: 66,972,637 probably null Het
Rapgef1 A G 2: 29,736,666 Y993C probably damaging Het
Scrn2 A C 11: 97,032,853 T219P probably benign Het
Sec23ip T G 7: 128,778,484 S874R probably damaging Het
Sept4 G A 11: 87,585,246 probably null Het
Slc15a3 C T 19: 10,857,251 L499F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sra1 A G 18: 36,667,575 M193T probably damaging Het
Srsf4 G T 4: 131,900,294 probably benign Het
Syne1 T C 10: 5,052,750 D8055G probably damaging Het
Syne4 T A 7: 30,316,563 probably null Het
Tbc1d24 C A 17: 24,208,229 G253V probably damaging Het
Tbck T A 3: 132,732,215 I467N probably damaging Het
Tln1 T A 4: 43,538,030 M1857L possibly damaging Het
Ttll2 T C 17: 7,351,632 R299G probably benign Het
Ugt2b36 T G 5: 87,066,213 E524A probably benign Het
Vmn2r124 C T 17: 18,062,851 T269I probably benign Het
Vmn2r4 A G 3: 64,406,943 F206L probably benign Het
Zfp346 A G 13: 55,115,574 K156R probably damaging Het
Other mutations in Gas7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Gas7 APN 11 67652914 critical splice donor site probably null
IGL01634:Gas7 APN 11 67674231 splice site probably benign
IGL02215:Gas7 APN 11 67643332 missense probably benign 0.33
IGL02338:Gas7 APN 11 67682731 missense probably damaging 0.99
IGL02547:Gas7 APN 11 67665435 missense probably damaging 0.99
IGL02679:Gas7 APN 11 67675727 splice site probably null
IGL02959:Gas7 APN 11 67674235 splice site probably benign
R0029:Gas7 UTSW 11 67643337 missense probably benign 0.05
R0335:Gas7 UTSW 11 67662052 missense possibly damaging 0.84
R0931:Gas7 UTSW 11 67652925 splice site probably benign
R1165:Gas7 UTSW 11 67670686 splice site probably benign
R1459:Gas7 UTSW 11 67662076 missense probably damaging 1.00
R2425:Gas7 UTSW 11 67643295 missense probably benign 0.00
R4953:Gas7 UTSW 11 67660050 missense possibly damaging 0.69
R4969:Gas7 UTSW 11 67683408 missense probably damaging 0.98
R5327:Gas7 UTSW 11 67662090 missense probably damaging 1.00
R6631:Gas7 UTSW 11 67674281 missense probably damaging 1.00
R6885:Gas7 UTSW 11 67683387 missense probably damaging 0.99
R6914:Gas7 UTSW 11 67660151 intron probably null
R6942:Gas7 UTSW 11 67660151 intron probably null
R8070:Gas7 UTSW 11 67683434 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGCCTTGGTTAAGAGATGC -3'
(R):5'- ATACCATAGCAGCTTTCAGGC -3'

Sequencing Primer
(F):5'- CTTGGTTAAGAGATGCTCTGCCAAG -3'
(R):5'- ATAGCAGCTTTCAGGCCCCAG -3'
Posted On2017-10-10