Incidental Mutation 'R6145:Abca8b'
ID 488831
Institutional Source Beutler Lab
Gene Symbol Abca8b
Ensembl Gene ENSMUSG00000020620
Gene Name ATP-binding cassette, sub-family A member 8b
Synonyms Abca8
MMRRC Submission 044292-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6145 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 109823016-109886671 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 109864634 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 316 (V316A)
Ref Sequence ENSEMBL: ENSMUSP00000102280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]
AlphaFold Q8K440
Predicted Effect probably benign
Transcript: ENSMUST00000020948
AA Change: V378A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: V378A

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 417 3.9e-28 PFAM
AAA 507 691 6.36e-10 SMART
Pfam:ABC2_membrane_3 859 1215 1e-10 PFAM
low complexity region 1246 1255 N/A INTRINSIC
AAA 1313 1492 6.17e-8 SMART
low complexity region 1597 1607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106669
AA Change: V316A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: V316A

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 344 2.6e-16 PFAM
AAA 445 629 6.36e-10 SMART
transmembrane domain 798 815 N/A INTRINSIC
transmembrane domain 1001 1023 N/A INTRINSIC
transmembrane domain 1038 1060 N/A INTRINSIC
transmembrane domain 1072 1091 N/A INTRINSIC
transmembrane domain 1101 1123 N/A INTRINSIC
transmembrane domain 1136 1158 N/A INTRINSIC
low complexity region 1184 1193 N/A INTRINSIC
AAA 1251 1430 6.17e-8 SMART
low complexity region 1535 1545 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 85,980,664 (GRCm39) probably null Het
Acad10 A T 5: 121,760,096 (GRCm39) V999D probably damaging Het
Acot8 A G 2: 164,644,985 (GRCm39) V66A probably benign Het
Ankrd11 T C 8: 123,619,400 (GRCm39) H1484R probably damaging Het
Anxa6 A G 11: 54,885,730 (GRCm39) F405S probably damaging Het
Asmt G A X: 169,108,398 (GRCm39) V101I probably damaging Het
Atp1a2 C T 1: 172,114,805 (GRCm39) V327I probably damaging Het
Brdt A G 5: 107,525,865 (GRCm39) E906G possibly damaging Het
Cacna1g A T 11: 94,353,087 (GRCm39) C313S probably damaging Het
Camk2d T C 3: 126,599,507 (GRCm39) I329T probably benign Het
Cavin4 A T 4: 48,663,794 (GRCm39) H58L probably damaging Het
Ccdc78 C A 17: 26,008,039 (GRCm39) P317T probably benign Het
Cdc16 T G 8: 13,817,573 (GRCm39) Y295D possibly damaging Het
Cdyl2 T A 8: 117,321,717 (GRCm39) N270I probably damaging Het
Cfap221 T A 1: 119,912,546 (GRCm39) I114F possibly damaging Het
Dmxl1 A G 18: 50,045,833 (GRCm39) E2414G possibly damaging Het
Dnaaf9 T C 2: 130,620,393 (GRCm39) I247V probably benign Het
Dnah1 C A 14: 31,022,927 (GRCm39) R1070L probably benign Het
Dnah14 T C 1: 181,493,982 (GRCm39) S1713P probably benign Het
Dock10 C A 1: 80,553,621 (GRCm39) G602* probably null Het
Ep400 A T 5: 110,904,569 (GRCm39) V10D possibly damaging Het
Epas1 T C 17: 87,136,857 (GRCm39) C807R probably benign Het
Esrrb C T 12: 86,552,673 (GRCm39) P200L probably benign Het
Fbxw26 T C 9: 109,561,691 (GRCm39) I168V probably benign Het
Fsip2 A T 2: 82,824,112 (GRCm39) H6615L possibly damaging Het
Galk2 A T 2: 125,788,762 (GRCm39) Q272L possibly damaging Het
Gas7 A C 11: 67,520,438 (GRCm39) T43P probably damaging Het
Gm5134 A T 10: 75,831,673 (GRCm39) I371F probably damaging Het
Gpr31b C T 17: 13,270,266 (GRCm39) R301Q possibly damaging Het
Grk1 T A 8: 13,455,765 (GRCm39) Y216* probably null Het
Grm5 T A 7: 87,675,809 (GRCm39) M441K probably damaging Het
Heatr6 A G 11: 83,656,962 (GRCm39) E408G probably damaging Het
Hoxc9 G T 15: 102,892,391 (GRCm39) K201N probably damaging Het
Igsf10 T A 3: 59,239,077 (GRCm39) Y368F possibly damaging Het
Il2ra A T 2: 11,685,057 (GRCm39) D131V probably damaging Het
Imp4 A G 1: 34,479,177 (GRCm39) E19G probably benign Het
Kcnk18 T C 19: 59,224,039 (GRCm39) *395Q probably null Het
Kdm6b A T 11: 69,295,852 (GRCm39) L805Q unknown Het
Lgr4 T A 2: 109,837,588 (GRCm39) L427* probably null Het
Myt1l G A 12: 29,882,380 (GRCm39) S525N unknown Het
Nasp G A 4: 116,468,274 (GRCm39) T237I probably benign Het
Nell2 G T 15: 95,371,442 (GRCm39) Q98K probably damaging Het
Nfasc C T 1: 132,562,455 (GRCm39) G107R probably damaging Het
Nsun4 A G 4: 115,897,403 (GRCm39) S203P probably damaging Het
Or1m1 T G 9: 18,666,865 (GRCm39) D22A probably benign Het
Or7g35 T C 9: 19,496,184 (GRCm39) V117A probably benign Het
Otogl G A 10: 107,612,978 (GRCm39) silent Het
Pde10a T C 17: 9,147,949 (GRCm39) V366A probably damaging Het
Pdxk T A 10: 78,279,625 (GRCm39) D250V probably benign Het
Pih1d1 T A 7: 44,808,468 (GRCm39) I179N probably damaging Het
Plaa T A 4: 94,472,229 (GRCm39) I294F probably damaging Het
Pmel C A 10: 128,551,804 (GRCm39) P213T probably damaging Het
Pom121l2 A T 13: 22,166,472 (GRCm39) R248* probably null Het
Pou2f1 T C 1: 165,703,002 (GRCm39) probably benign Het
Ppm1j G A 3: 104,688,695 (GRCm39) R98H probably damaging Het
Prkdc C T 16: 15,589,937 (GRCm39) P2600L probably damaging Het
Prom1 T C 5: 44,186,991 (GRCm39) N422S probably benign Het
Pspn C T 17: 57,306,467 (GRCm39) C154Y probably damaging Het
Ptdss1 T C 13: 67,120,701 (GRCm39) probably null Het
Rapgef1 A G 2: 29,626,678 (GRCm39) Y993C probably damaging Het
Scrn2 A C 11: 96,923,679 (GRCm39) T219P probably benign Het
Sec23ip T G 7: 128,380,208 (GRCm39) S874R probably damaging Het
Septin4 G A 11: 87,476,072 (GRCm39) probably null Het
Slc15a3 C T 19: 10,834,615 (GRCm39) L499F probably damaging Het
Spaca9 G A 2: 28,583,793 (GRCm39) R64W probably damaging Het
Sra1 A G 18: 36,800,628 (GRCm39) M193T probably damaging Het
Srsf4 G T 4: 131,627,605 (GRCm39) probably benign Het
Syne1 T C 10: 5,002,750 (GRCm39) D8055G probably damaging Het
Syne4 T A 7: 30,015,988 (GRCm39) probably null Het
Tbc1d24 C A 17: 24,427,203 (GRCm39) G253V probably damaging Het
Tbck T A 3: 132,437,976 (GRCm39) I467N probably damaging Het
Tln1 T A 4: 43,538,030 (GRCm39) M1857L possibly damaging Het
Ttll2 T C 17: 7,619,031 (GRCm39) R299G probably benign Het
Ugt2b36 T G 5: 87,214,072 (GRCm39) E524A probably benign Het
Vmn2r124 C T 17: 18,283,113 (GRCm39) T269I probably benign Het
Vmn2r4 A G 3: 64,314,364 (GRCm39) F206L probably benign Het
Zfp346 A G 13: 55,263,387 (GRCm39) K156R probably damaging Het
Other mutations in Abca8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Abca8b APN 11 109,844,374 (GRCm39) missense possibly damaging 0.66
IGL00952:Abca8b APN 11 109,859,886 (GRCm39) critical splice donor site probably null
IGL01141:Abca8b APN 11 109,828,556 (GRCm39) missense probably damaging 1.00
IGL01523:Abca8b APN 11 109,867,320 (GRCm39) missense probably damaging 1.00
IGL01633:Abca8b APN 11 109,827,580 (GRCm39) missense probably damaging 0.99
IGL01862:Abca8b APN 11 109,837,997 (GRCm39) nonsense probably null
IGL01963:Abca8b APN 11 109,862,589 (GRCm39) missense probably damaging 0.99
IGL02169:Abca8b APN 11 109,843,408 (GRCm39) missense probably damaging 0.98
IGL02536:Abca8b APN 11 109,872,574 (GRCm39) missense probably benign 0.02
IGL02658:Abca8b APN 11 109,843,386 (GRCm39) missense probably benign
IGL02828:Abca8b APN 11 109,871,720 (GRCm39) missense probably damaging 0.99
IGL03118:Abca8b APN 11 109,838,007 (GRCm39) missense possibly damaging 0.66
IGL03302:Abca8b APN 11 109,858,576 (GRCm39) missense possibly damaging 0.80
IGL03325:Abca8b APN 11 109,844,422 (GRCm39) missense possibly damaging 0.94
R0057:Abca8b UTSW 11 109,832,385 (GRCm39) missense possibly damaging 0.91
R0131:Abca8b UTSW 11 109,833,115 (GRCm39) missense possibly damaging 0.46
R0226:Abca8b UTSW 11 109,847,844 (GRCm39) splice site probably null
R0426:Abca8b UTSW 11 109,845,853 (GRCm39) splice site probably benign
R0432:Abca8b UTSW 11 109,870,841 (GRCm39) missense possibly damaging 0.94
R0512:Abca8b UTSW 11 109,841,476 (GRCm39) missense probably benign 0.32
R0589:Abca8b UTSW 11 109,833,094 (GRCm39) missense probably damaging 0.96
R0690:Abca8b UTSW 11 109,860,634 (GRCm39) splice site probably benign
R1263:Abca8b UTSW 11 109,832,433 (GRCm39) missense possibly damaging 0.66
R1371:Abca8b UTSW 11 109,844,379 (GRCm39) missense probably damaging 0.99
R1497:Abca8b UTSW 11 109,864,647 (GRCm39) splice site probably benign
R1502:Abca8b UTSW 11 109,865,471 (GRCm39) missense probably damaging 1.00
R1517:Abca8b UTSW 11 109,862,640 (GRCm39) missense possibly damaging 0.66
R1543:Abca8b UTSW 11 109,865,500 (GRCm39) missense probably damaging 0.98
R1618:Abca8b UTSW 11 109,840,714 (GRCm39) splice site probably benign
R1625:Abca8b UTSW 11 109,857,947 (GRCm39) missense probably benign 0.11
R1753:Abca8b UTSW 11 109,864,542 (GRCm39) missense probably benign 0.00
R1819:Abca8b UTSW 11 109,871,882 (GRCm39) critical splice acceptor site probably null
R1822:Abca8b UTSW 11 109,847,901 (GRCm39) missense possibly damaging 0.92
R1829:Abca8b UTSW 11 109,833,167 (GRCm39) missense probably damaging 0.97
R1873:Abca8b UTSW 11 109,870,781 (GRCm39) missense probably benign 0.01
R1899:Abca8b UTSW 11 109,828,744 (GRCm39) missense possibly damaging 0.92
R1908:Abca8b UTSW 11 109,847,924 (GRCm39) missense possibly damaging 0.92
R1962:Abca8b UTSW 11 109,870,724 (GRCm39) missense probably benign 0.00
R1984:Abca8b UTSW 11 109,868,667 (GRCm39) missense probably damaging 1.00
R2035:Abca8b UTSW 11 109,847,932 (GRCm39) missense possibly damaging 0.94
R2092:Abca8b UTSW 11 109,857,534 (GRCm39) missense possibly damaging 0.63
R2100:Abca8b UTSW 11 109,828,608 (GRCm39) missense probably damaging 1.00
R2267:Abca8b UTSW 11 109,845,974 (GRCm39) missense probably benign 0.03
R2871:Abca8b UTSW 11 109,846,002 (GRCm39) missense possibly damaging 0.83
R2871:Abca8b UTSW 11 109,846,002 (GRCm39) missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109,846,002 (GRCm39) missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109,846,002 (GRCm39) missense possibly damaging 0.83
R2873:Abca8b UTSW 11 109,846,002 (GRCm39) missense possibly damaging 0.83
R3711:Abca8b UTSW 11 109,837,081 (GRCm39) missense possibly damaging 0.46
R3937:Abca8b UTSW 11 109,865,393 (GRCm39) missense probably benign 0.01
R4052:Abca8b UTSW 11 109,872,551 (GRCm39) nonsense probably null
R4060:Abca8b UTSW 11 109,848,027 (GRCm39) missense probably benign 0.04
R4207:Abca8b UTSW 11 109,872,551 (GRCm39) nonsense probably null
R4208:Abca8b UTSW 11 109,872,551 (GRCm39) nonsense probably null
R4354:Abca8b UTSW 11 109,862,518 (GRCm39) missense probably benign 0.27
R4399:Abca8b UTSW 11 109,827,211 (GRCm39) missense possibly damaging 0.66
R4456:Abca8b UTSW 11 109,833,071 (GRCm39) missense probably benign 0.27
R4509:Abca8b UTSW 11 109,857,581 (GRCm39) missense probably damaging 1.00
R4672:Abca8b UTSW 11 109,827,274 (GRCm39) missense possibly damaging 0.81
R4868:Abca8b UTSW 11 109,865,338 (GRCm39) missense probably benign 0.05
R5002:Abca8b UTSW 11 109,852,623 (GRCm39) missense probably damaging 0.96
R5007:Abca8b UTSW 11 109,827,590 (GRCm39) missense probably damaging 1.00
R5014:Abca8b UTSW 11 109,840,957 (GRCm39) missense probably damaging 0.98
R5023:Abca8b UTSW 11 109,865,814 (GRCm39) critical splice donor site probably null
R5091:Abca8b UTSW 11 109,827,210 (GRCm39) missense possibly damaging 0.92
R5098:Abca8b UTSW 11 109,847,944 (GRCm39) missense probably benign 0.05
R5117:Abca8b UTSW 11 109,857,629 (GRCm39) missense probably damaging 1.00
R5234:Abca8b UTSW 11 109,867,420 (GRCm39) missense possibly damaging 0.90
R5302:Abca8b UTSW 11 109,868,639 (GRCm39) missense probably damaging 1.00
R5307:Abca8b UTSW 11 109,868,639 (GRCm39) missense probably damaging 1.00
R5487:Abca8b UTSW 11 109,844,340 (GRCm39) missense probably damaging 0.99
R5512:Abca8b UTSW 11 109,868,639 (GRCm39) missense probably damaging 1.00
R5564:Abca8b UTSW 11 109,825,407 (GRCm39) missense probably benign 0.08
R5610:Abca8b UTSW 11 109,868,639 (GRCm39) missense probably damaging 1.00
R5677:Abca8b UTSW 11 109,831,687 (GRCm39) missense probably damaging 1.00
R5723:Abca8b UTSW 11 109,844,445 (GRCm39) missense possibly damaging 0.90
R5827:Abca8b UTSW 11 109,868,639 (GRCm39) missense probably damaging 1.00
R5829:Abca8b UTSW 11 109,868,639 (GRCm39) missense probably damaging 1.00
R5848:Abca8b UTSW 11 109,868,639 (GRCm39) missense probably damaging 1.00
R5849:Abca8b UTSW 11 109,868,639 (GRCm39) missense probably damaging 1.00
R5850:Abca8b UTSW 11 109,868,639 (GRCm39) missense probably damaging 1.00
R5854:Abca8b UTSW 11 109,868,639 (GRCm39) missense probably damaging 1.00
R5982:Abca8b UTSW 11 109,844,423 (GRCm39) missense possibly damaging 0.80
R5994:Abca8b UTSW 11 109,840,592 (GRCm39) splice site probably null
R6035:Abca8b UTSW 11 109,862,686 (GRCm39) splice site probably null
R6035:Abca8b UTSW 11 109,862,686 (GRCm39) splice site probably null
R6050:Abca8b UTSW 11 109,868,639 (GRCm39) missense probably damaging 1.00
R6223:Abca8b UTSW 11 109,868,672 (GRCm39) missense probably benign 0.00
R6349:Abca8b UTSW 11 109,825,544 (GRCm39) splice site probably null
R7002:Abca8b UTSW 11 109,832,390 (GRCm39) missense probably damaging 1.00
R7050:Abca8b UTSW 11 109,864,544 (GRCm39) missense possibly damaging 0.90
R7107:Abca8b UTSW 11 109,867,299 (GRCm39) missense probably damaging 0.98
R7158:Abca8b UTSW 11 109,825,415 (GRCm39) missense probably damaging 1.00
R7170:Abca8b UTSW 11 109,836,654 (GRCm39) missense probably benign 0.09
R7197:Abca8b UTSW 11 109,836,648 (GRCm39) nonsense probably null
R7220:Abca8b UTSW 11 109,872,543 (GRCm39) missense probably damaging 1.00
R7512:Abca8b UTSW 11 109,829,275 (GRCm39) missense probably benign 0.01
R7590:Abca8b UTSW 11 109,829,341 (GRCm39) missense probably damaging 0.97
R7658:Abca8b UTSW 11 109,826,543 (GRCm39) missense probably benign 0.00
R7739:Abca8b UTSW 11 109,865,417 (GRCm39) missense probably benign 0.05
R7797:Abca8b UTSW 11 109,862,509 (GRCm39) critical splice donor site probably null
R7934:Abca8b UTSW 11 109,865,865 (GRCm39) missense possibly damaging 0.75
R8074:Abca8b UTSW 11 109,829,320 (GRCm39) missense probably benign
R8302:Abca8b UTSW 11 109,853,406 (GRCm39) critical splice donor site probably null
R8341:Abca8b UTSW 11 109,845,876 (GRCm39) missense probably damaging 1.00
R8486:Abca8b UTSW 11 109,857,937 (GRCm39) missense possibly damaging 0.83
R8748:Abca8b UTSW 11 109,836,597 (GRCm39) missense probably damaging 1.00
R8924:Abca8b UTSW 11 109,838,003 (GRCm39) missense probably benign 0.00
R9002:Abca8b UTSW 11 109,843,456 (GRCm39) missense probably benign 0.02
R9032:Abca8b UTSW 11 109,848,073 (GRCm39) missense probably benign 0.04
R9099:Abca8b UTSW 11 109,871,708 (GRCm39) missense probably damaging 1.00
R9124:Abca8b UTSW 11 109,828,593 (GRCm39) missense probably damaging 0.97
R9178:Abca8b UTSW 11 109,840,937 (GRCm39) missense probably benign 0.00
R9188:Abca8b UTSW 11 109,872,561 (GRCm39) nonsense probably null
R9277:Abca8b UTSW 11 109,867,347 (GRCm39) missense probably damaging 0.99
R9340:Abca8b UTSW 11 109,840,939 (GRCm39) missense probably benign 0.43
R9371:Abca8b UTSW 11 109,858,498 (GRCm39) missense probably damaging 1.00
R9382:Abca8b UTSW 11 109,870,711 (GRCm39) missense probably benign
R9450:Abca8b UTSW 11 109,859,930 (GRCm39) missense probably damaging 0.98
R9462:Abca8b UTSW 11 109,844,433 (GRCm39) missense
R9712:Abca8b UTSW 11 109,833,163 (GRCm39) missense probably benign 0.30
Z1088:Abca8b UTSW 11 109,867,308 (GRCm39) missense probably benign 0.09
Z1176:Abca8b UTSW 11 109,865,470 (GRCm39) missense possibly damaging 0.87
Z1176:Abca8b UTSW 11 109,852,734 (GRCm39) missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CATGCCTTAGGAAATCTGGTTGG -3'
(R):5'- GCACTTACTGTTATAGTTGCGC -3'

Sequencing Primer
(F):5'- CTGGTTGGGGAATGCAATTTATTAC -3'
(R):5'- GTTGCGCATATGTCCATACTACAG -3'
Posted On 2017-10-10