Incidental Mutation 'R6145:Myt1l'
ID 488832
Institutional Source Beutler Lab
Gene Symbol Myt1l
Ensembl Gene ENSMUSG00000061911
Gene Name myelin transcription factor 1-like
Synonyms 2900093J19Rik, Png-1, 2900046C06Rik, C630034G21Rik, Nztf1, Pmng1
MMRRC Submission 044292-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6145 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 29578383-29973212 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 29882380 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 525 (S525N)
Ref Sequence ENSEMBL: ENSMUSP00000151588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021009] [ENSMUST00000049784] [ENSMUST00000218583]
AlphaFold P97500
Predicted Effect unknown
Transcript: ENSMUST00000021009
AA Change: S525N
SMART Domains Protein: ENSMUSP00000021009
Gene: ENSMUSG00000061911
AA Change: S525N

DomainStartEndE-ValueType
Pfam:zf-C2HC 28 58 8.3e-19 PFAM
coiled coil region 148 182 N/A INTRINSIC
low complexity region 188 200 N/A INTRINSIC
low complexity region 222 233 N/A INTRINSIC
Pfam:zf-C2HC 502 532 1.1e-16 PFAM
Pfam:zf-C2HC 546 576 4e-18 PFAM
Pfam:MYT1 620 872 2.7e-135 PFAM
Pfam:zf-C2HC 901 931 8.4e-20 PFAM
Pfam:zf-C2HC 950 980 1.2e-18 PFAM
Pfam:zf-C2HC 1003 1033 1.1e-17 PFAM
coiled coil region 1055 1130 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000049784
AA Change: S527N
SMART Domains Protein: ENSMUSP00000058264
Gene: ENSMUSG00000061911
AA Change: S527N

DomainStartEndE-ValueType
Pfam:zf-C2HC 30 58 5.1e-18 PFAM
coiled coil region 148 182 N/A INTRINSIC
low complexity region 188 200 N/A INTRINSIC
low complexity region 222 233 N/A INTRINSIC
Pfam:zf-C2HC 506 533 9.9e-15 PFAM
Pfam:zf-C2HC 550 578 2.4e-16 PFAM
Pfam:MYT1 622 873 2.7e-122 PFAM
Pfam:zf-C2HC 905 933 6.3e-19 PFAM
Pfam:zf-C2HC 954 982 1.6e-18 PFAM
Pfam:zf-C2HC 1007 1035 1.4e-16 PFAM
coiled coil region 1057 1132 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000218583
AA Change: S525N
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc finger superfamily of transcription factors. The encoded protein belongs to a novel class of cystein-cystein-histidine-cystein zinc finger proteins that function in the developing mammalian central nervous system. Forced expression of this gene in combination with the basic helix-loop-helix transcription factor NeuroD1 and the transcription factors POU class 3 homeobox 2 and achaete-scute family basic helix-loop-helix transcription factor 1 can convert fetal and postnatal human fibroblasts into induced neuronal cells, which are able to generate action potentials. Mutations in this gene have been associated with autosomal mental retardation-39 and autism spectrum disorder. Alternative splicing results in multiple variants. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 85,980,664 (GRCm39) probably null Het
Abca8b A G 11: 109,864,634 (GRCm39) V316A probably benign Het
Acad10 A T 5: 121,760,096 (GRCm39) V999D probably damaging Het
Acot8 A G 2: 164,644,985 (GRCm39) V66A probably benign Het
Ankrd11 T C 8: 123,619,400 (GRCm39) H1484R probably damaging Het
Anxa6 A G 11: 54,885,730 (GRCm39) F405S probably damaging Het
Asmt G A X: 169,108,398 (GRCm39) V101I probably damaging Het
Atp1a2 C T 1: 172,114,805 (GRCm39) V327I probably damaging Het
Brdt A G 5: 107,525,865 (GRCm39) E906G possibly damaging Het
Cacna1g A T 11: 94,353,087 (GRCm39) C313S probably damaging Het
Camk2d T C 3: 126,599,507 (GRCm39) I329T probably benign Het
Cavin4 A T 4: 48,663,794 (GRCm39) H58L probably damaging Het
Ccdc78 C A 17: 26,008,039 (GRCm39) P317T probably benign Het
Cdc16 T G 8: 13,817,573 (GRCm39) Y295D possibly damaging Het
Cdyl2 T A 8: 117,321,717 (GRCm39) N270I probably damaging Het
Cfap221 T A 1: 119,912,546 (GRCm39) I114F possibly damaging Het
Dmxl1 A G 18: 50,045,833 (GRCm39) E2414G possibly damaging Het
Dnaaf9 T C 2: 130,620,393 (GRCm39) I247V probably benign Het
Dnah1 C A 14: 31,022,927 (GRCm39) R1070L probably benign Het
Dnah14 T C 1: 181,493,982 (GRCm39) S1713P probably benign Het
Dock10 C A 1: 80,553,621 (GRCm39) G602* probably null Het
Ep400 A T 5: 110,904,569 (GRCm39) V10D possibly damaging Het
Epas1 T C 17: 87,136,857 (GRCm39) C807R probably benign Het
Esrrb C T 12: 86,552,673 (GRCm39) P200L probably benign Het
Fbxw26 T C 9: 109,561,691 (GRCm39) I168V probably benign Het
Fsip2 A T 2: 82,824,112 (GRCm39) H6615L possibly damaging Het
Galk2 A T 2: 125,788,762 (GRCm39) Q272L possibly damaging Het
Gas7 A C 11: 67,520,438 (GRCm39) T43P probably damaging Het
Gm5134 A T 10: 75,831,673 (GRCm39) I371F probably damaging Het
Gpr31b C T 17: 13,270,266 (GRCm39) R301Q possibly damaging Het
Grk1 T A 8: 13,455,765 (GRCm39) Y216* probably null Het
Grm5 T A 7: 87,675,809 (GRCm39) M441K probably damaging Het
Heatr6 A G 11: 83,656,962 (GRCm39) E408G probably damaging Het
Hoxc9 G T 15: 102,892,391 (GRCm39) K201N probably damaging Het
Igsf10 T A 3: 59,239,077 (GRCm39) Y368F possibly damaging Het
Il2ra A T 2: 11,685,057 (GRCm39) D131V probably damaging Het
Imp4 A G 1: 34,479,177 (GRCm39) E19G probably benign Het
Kcnk18 T C 19: 59,224,039 (GRCm39) *395Q probably null Het
Kdm6b A T 11: 69,295,852 (GRCm39) L805Q unknown Het
Lgr4 T A 2: 109,837,588 (GRCm39) L427* probably null Het
Nasp G A 4: 116,468,274 (GRCm39) T237I probably benign Het
Nell2 G T 15: 95,371,442 (GRCm39) Q98K probably damaging Het
Nfasc C T 1: 132,562,455 (GRCm39) G107R probably damaging Het
Nsun4 A G 4: 115,897,403 (GRCm39) S203P probably damaging Het
Or1m1 T G 9: 18,666,865 (GRCm39) D22A probably benign Het
Or7g35 T C 9: 19,496,184 (GRCm39) V117A probably benign Het
Otogl G A 10: 107,612,978 (GRCm39) silent Het
Pde10a T C 17: 9,147,949 (GRCm39) V366A probably damaging Het
Pdxk T A 10: 78,279,625 (GRCm39) D250V probably benign Het
Pih1d1 T A 7: 44,808,468 (GRCm39) I179N probably damaging Het
Plaa T A 4: 94,472,229 (GRCm39) I294F probably damaging Het
Pmel C A 10: 128,551,804 (GRCm39) P213T probably damaging Het
Pom121l2 A T 13: 22,166,472 (GRCm39) R248* probably null Het
Pou2f1 T C 1: 165,703,002 (GRCm39) probably benign Het
Ppm1j G A 3: 104,688,695 (GRCm39) R98H probably damaging Het
Prkdc C T 16: 15,589,937 (GRCm39) P2600L probably damaging Het
Prom1 T C 5: 44,186,991 (GRCm39) N422S probably benign Het
Pspn C T 17: 57,306,467 (GRCm39) C154Y probably damaging Het
Ptdss1 T C 13: 67,120,701 (GRCm39) probably null Het
Rapgef1 A G 2: 29,626,678 (GRCm39) Y993C probably damaging Het
Scrn2 A C 11: 96,923,679 (GRCm39) T219P probably benign Het
Sec23ip T G 7: 128,380,208 (GRCm39) S874R probably damaging Het
Septin4 G A 11: 87,476,072 (GRCm39) probably null Het
Slc15a3 C T 19: 10,834,615 (GRCm39) L499F probably damaging Het
Spaca9 G A 2: 28,583,793 (GRCm39) R64W probably damaging Het
Sra1 A G 18: 36,800,628 (GRCm39) M193T probably damaging Het
Srsf4 G T 4: 131,627,605 (GRCm39) probably benign Het
Syne1 T C 10: 5,002,750 (GRCm39) D8055G probably damaging Het
Syne4 T A 7: 30,015,988 (GRCm39) probably null Het
Tbc1d24 C A 17: 24,427,203 (GRCm39) G253V probably damaging Het
Tbck T A 3: 132,437,976 (GRCm39) I467N probably damaging Het
Tln1 T A 4: 43,538,030 (GRCm39) M1857L possibly damaging Het
Ttll2 T C 17: 7,619,031 (GRCm39) R299G probably benign Het
Ugt2b36 T G 5: 87,214,072 (GRCm39) E524A probably benign Het
Vmn2r124 C T 17: 18,283,113 (GRCm39) T269I probably benign Het
Vmn2r4 A G 3: 64,314,364 (GRCm39) F206L probably benign Het
Zfp346 A G 13: 55,263,387 (GRCm39) K156R probably damaging Het
Other mutations in Myt1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Myt1l APN 12 29,877,423 (GRCm39) missense unknown
IGL00896:Myt1l APN 12 29,876,885 (GRCm39) missense unknown
IGL01653:Myt1l APN 12 29,960,770 (GRCm39) missense unknown
IGL02632:Myt1l APN 12 29,964,292 (GRCm39) missense unknown
IGL03088:Myt1l APN 12 29,970,476 (GRCm39) missense probably benign 0.03
IGL03212:Myt1l APN 12 29,877,819 (GRCm39) missense unknown
BB003:Myt1l UTSW 12 29,861,651 (GRCm39) missense unknown
BB013:Myt1l UTSW 12 29,861,651 (GRCm39) missense unknown
R0057:Myt1l UTSW 12 29,892,611 (GRCm39) splice site probably null
R0126:Myt1l UTSW 12 29,901,719 (GRCm39) missense possibly damaging 0.91
R0356:Myt1l UTSW 12 29,861,500 (GRCm39) missense unknown
R0538:Myt1l UTSW 12 29,892,570 (GRCm39) missense possibly damaging 0.47
R0587:Myt1l UTSW 12 29,861,634 (GRCm39) missense unknown
R0629:Myt1l UTSW 12 29,861,484 (GRCm39) missense unknown
R0709:Myt1l UTSW 12 29,877,732 (GRCm39) missense unknown
R0736:Myt1l UTSW 12 29,877,813 (GRCm39) missense unknown
R0920:Myt1l UTSW 12 29,936,138 (GRCm39) missense unknown
R1618:Myt1l UTSW 12 29,877,396 (GRCm39) missense unknown
R1660:Myt1l UTSW 12 29,945,272 (GRCm39) missense unknown
R1716:Myt1l UTSW 12 29,861,537 (GRCm39) missense unknown
R1758:Myt1l UTSW 12 29,877,241 (GRCm39) missense unknown
R1852:Myt1l UTSW 12 29,901,660 (GRCm39) missense probably benign 0.27
R1971:Myt1l UTSW 12 29,877,091 (GRCm39) missense unknown
R2120:Myt1l UTSW 12 29,833,618 (GRCm39) critical splice acceptor site probably null
R2227:Myt1l UTSW 12 29,876,969 (GRCm39) missense unknown
R2865:Myt1l UTSW 12 29,960,788 (GRCm39) missense probably benign 0.00
R4587:Myt1l UTSW 12 29,960,800 (GRCm39) missense unknown
R4603:Myt1l UTSW 12 29,892,539 (GRCm39) missense probably benign 0.01
R4659:Myt1l UTSW 12 29,899,456 (GRCm39) missense probably damaging 0.98
R4734:Myt1l UTSW 12 29,969,925 (GRCm39) missense possibly damaging 0.90
R4786:Myt1l UTSW 12 29,861,457 (GRCm39) missense unknown
R4824:Myt1l UTSW 12 29,899,399 (GRCm39) missense probably benign 0.02
R4835:Myt1l UTSW 12 29,945,304 (GRCm39) missense unknown
R4888:Myt1l UTSW 12 29,936,138 (GRCm39) missense unknown
R4976:Myt1l UTSW 12 29,882,302 (GRCm39) missense unknown
R4980:Myt1l UTSW 12 29,877,038 (GRCm39) missense unknown
R5119:Myt1l UTSW 12 29,882,302 (GRCm39) missense unknown
R5194:Myt1l UTSW 12 29,861,647 (GRCm39) missense unknown
R5247:Myt1l UTSW 12 29,882,331 (GRCm39) missense unknown
R5249:Myt1l UTSW 12 29,882,331 (GRCm39) missense unknown
R5427:Myt1l UTSW 12 29,882,331 (GRCm39) missense unknown
R5428:Myt1l UTSW 12 29,882,331 (GRCm39) missense unknown
R5429:Myt1l UTSW 12 29,882,331 (GRCm39) missense unknown
R5431:Myt1l UTSW 12 29,882,331 (GRCm39) missense unknown
R5628:Myt1l UTSW 12 29,861,620 (GRCm39) missense unknown
R5926:Myt1l UTSW 12 29,882,331 (GRCm39) missense unknown
R5959:Myt1l UTSW 12 29,970,039 (GRCm39) critical splice donor site probably null
R6082:Myt1l UTSW 12 29,892,518 (GRCm39) missense probably damaging 1.00
R6082:Myt1l UTSW 12 29,882,331 (GRCm39) missense unknown
R6084:Myt1l UTSW 12 29,882,331 (GRCm39) missense unknown
R6086:Myt1l UTSW 12 29,882,331 (GRCm39) missense unknown
R6293:Myt1l UTSW 12 29,877,627 (GRCm39) missense unknown
R6315:Myt1l UTSW 12 29,877,797 (GRCm39) missense unknown
R6458:Myt1l UTSW 12 29,945,298 (GRCm39) missense unknown
R6490:Myt1l UTSW 12 29,882,365 (GRCm39) missense unknown
R6758:Myt1l UTSW 12 29,892,599 (GRCm39) missense possibly damaging 0.94
R7230:Myt1l UTSW 12 29,833,873 (GRCm39) missense probably damaging 0.99
R7330:Myt1l UTSW 12 29,901,553 (GRCm39) missense unknown
R7545:Myt1l UTSW 12 29,877,087 (GRCm39) missense unknown
R7662:Myt1l UTSW 12 29,876,868 (GRCm39) missense unknown
R7744:Myt1l UTSW 12 29,877,548 (GRCm39) missense unknown
R7926:Myt1l UTSW 12 29,861,651 (GRCm39) missense unknown
R8832:Myt1l UTSW 12 29,970,351 (GRCm39) missense unknown
R8903:Myt1l UTSW 12 29,861,468 (GRCm39) missense unknown
R8923:Myt1l UTSW 12 29,960,800 (GRCm39) missense unknown
R8935:Myt1l UTSW 12 29,877,243 (GRCm39) missense unknown
R8944:Myt1l UTSW 12 29,861,564 (GRCm39) missense unknown
R9000:Myt1l UTSW 12 29,901,740 (GRCm39) missense unknown
R9329:Myt1l UTSW 12 29,901,659 (GRCm39) missense unknown
R9523:Myt1l UTSW 12 29,877,611 (GRCm39) missense unknown
R9599:Myt1l UTSW 12 29,943,441 (GRCm39) missense unknown
U24488:Myt1l UTSW 12 29,876,895 (GRCm39) missense unknown
Z1177:Myt1l UTSW 12 29,892,467 (GRCm39) missense unknown
Z1177:Myt1l UTSW 12 29,861,430 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCAGGTTGCTGGATAACC -3'
(R):5'- TGTTCCAGGGAGTCAGCTTCAG -3'

Sequencing Primer
(F):5'- ATAACCGCATGAGTCTGCAGTTG -3'
(R):5'- TGGTACCCAGAATATCCAGGAG -3'
Posted On 2017-10-10