Incidental Mutation 'R6145:Vmn2r124'
ID488844
Institutional Source Beutler Lab
Gene Symbol Vmn2r124
Ensembl Gene ENSMUSG00000094396
Gene Namevomeronasal 2, receptor 124
SynonymsGm7196, Vmn2r-ps113
MMRRC Submission 044292-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6145 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location18049424-18079732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18062851 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 269 (T269I)
Ref Sequence ENSEMBL: ENSMUSP00000135613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176802] [ENSMUST00000231546]
Predicted Effect probably benign
Transcript: ENSMUST00000176802
AA Change: T269I

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000135613
Gene: ENSMUSG00000094396
AA Change: T269I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 84 449 2.2e-37 PFAM
Pfam:NCD3G 510 563 9.3e-21 PFAM
Pfam:7tm_3 596 831 1.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231546
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 86,052,942 probably null Het
4930402H24Rik T C 2: 130,778,473 I247V probably benign Het
Abca8b A G 11: 109,973,808 V316A probably benign Het
Acad10 A T 5: 121,622,033 V999D probably damaging Het
Acot8 A G 2: 164,803,065 V66A probably benign Het
Ankrd11 T C 8: 122,892,661 H1484R probably damaging Het
Anxa6 A G 11: 54,994,904 F405S probably damaging Het
Asmt G A X: 170,674,663 V101I probably damaging Het
Atp1a2 C T 1: 172,287,238 V327I probably damaging Het
Brdt A G 5: 107,377,999 E906G possibly damaging Het
Cacna1g A T 11: 94,462,261 C313S probably damaging Het
Camk2d T C 3: 126,805,858 I329T probably benign Het
Cavin4 A T 4: 48,663,794 H58L probably damaging Het
Ccdc78 C A 17: 25,789,065 P317T probably benign Het
Cdc16 T G 8: 13,767,573 Y295D possibly damaging Het
Cdyl2 T A 8: 116,594,978 N270I probably damaging Het
Cfap221 T A 1: 119,984,816 I114F possibly damaging Het
Dmxl1 A G 18: 49,912,766 E2414G possibly damaging Het
Dnah1 C A 14: 31,300,970 R1070L probably benign Het
Dnah14 T C 1: 181,666,417 S1713P probably benign Het
Dock10 C A 1: 80,575,904 G602* probably null Het
Ep400 A T 5: 110,756,703 V10D possibly damaging Het
Epas1 T C 17: 86,829,429 C807R probably benign Het
Esrrb C T 12: 86,505,899 P200L probably benign Het
Fbxw26 T C 9: 109,732,623 I168V probably benign Het
Fsip2 A T 2: 82,993,768 H6615L possibly damaging Het
Galk2 A T 2: 125,946,842 Q272L possibly damaging Het
Gas7 A C 11: 67,629,612 T43P probably damaging Het
Gm5134 A T 10: 75,995,839 I371F probably damaging Het
Gpr31b C T 17: 13,051,379 R301Q possibly damaging Het
Grk1 T A 8: 13,405,765 Y216* probably null Het
Grm5 T A 7: 88,026,601 M441K probably damaging Het
Heatr6 A G 11: 83,766,136 E408G probably damaging Het
Hoxc9 G T 15: 102,983,959 K201N probably damaging Het
Igsf10 T A 3: 59,331,656 Y368F possibly damaging Het
Il2ra A T 2: 11,680,246 D131V probably damaging Het
Imp4 A G 1: 34,440,096 E19G probably benign Het
Kcnk18 T C 19: 59,235,607 *395Q probably null Het
Kdm6b A T 11: 69,405,026 L805Q unknown Het
Lgr4 T A 2: 110,007,243 L427* probably null Het
Myt1l G A 12: 29,832,381 S525N unknown Het
Nasp G A 4: 116,611,077 T237I probably benign Het
Nell2 G T 15: 95,473,561 Q98K probably damaging Het
Nfasc C T 1: 132,634,717 G107R probably damaging Het
Nsun4 A G 4: 116,040,206 S203P probably damaging Het
Olfr24 T G 9: 18,755,569 D22A probably benign Het
Olfr855 T C 9: 19,584,888 V117A probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pde10a T C 17: 8,929,117 V366A probably damaging Het
Pdxk T A 10: 78,443,791 D250V probably benign Het
Pih1d1 T A 7: 45,159,044 I179N probably damaging Het
Plaa T A 4: 94,583,992 I294F probably damaging Het
Pmel C A 10: 128,715,935 P213T probably damaging Het
Pom121l2 A T 13: 21,982,302 R248* probably null Het
Pou2f1 T C 1: 165,875,433 probably benign Het
Ppm1j G A 3: 104,781,379 R98H probably damaging Het
Prkdc C T 16: 15,772,073 P2600L probably damaging Het
Prom1 T C 5: 44,029,649 N422S probably benign Het
Pspn C T 17: 56,999,467 C154Y probably damaging Het
Ptdss1 T C 13: 66,972,637 probably null Het
Rapgef1 A G 2: 29,736,666 Y993C probably damaging Het
Scrn2 A C 11: 97,032,853 T219P probably benign Het
Sec23ip T G 7: 128,778,484 S874R probably damaging Het
Sept4 G A 11: 87,585,246 probably null Het
Slc15a3 C T 19: 10,857,251 L499F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sra1 A G 18: 36,667,575 M193T probably damaging Het
Srsf4 G T 4: 131,900,294 probably benign Het
Syne1 T C 10: 5,052,750 D8055G probably damaging Het
Syne4 T A 7: 30,316,563 probably null Het
Tbc1d24 C A 17: 24,208,229 G253V probably damaging Het
Tbck T A 3: 132,732,215 I467N probably damaging Het
Tln1 T A 4: 43,538,030 M1857L possibly damaging Het
Ttll2 T C 17: 7,351,632 R299G probably benign Het
Ugt2b36 T G 5: 87,066,213 E524A probably benign Het
Vmn2r4 A G 3: 64,406,943 F206L probably benign Het
Zfp346 A G 13: 55,115,574 K156R probably damaging Het
Other mutations in Vmn2r124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Vmn2r124 APN 17 18062670 missense probably benign 0.04
IGL01356:Vmn2r124 APN 17 18073471 missense probably benign 0.08
IGL01387:Vmn2r124 APN 17 18062926 missense probably damaging 0.98
IGL01413:Vmn2r124 APN 17 18062565 missense probably benign 0.41
IGL01550:Vmn2r124 APN 17 18063355 critical splice donor site probably null
IGL01759:Vmn2r124 APN 17 18064068 missense probably benign 0.00
IGL01762:Vmn2r124 APN 17 18063172 missense possibly damaging 0.51
IGL02132:Vmn2r124 APN 17 18064229 splice site probably benign
IGL02290:Vmn2r124 APN 17 18073335 missense probably benign 0.09
IGL02370:Vmn2r124 APN 17 18064191 missense probably benign 0.14
IGL02527:Vmn2r124 APN 17 18066502 critical splice acceptor site probably null
PIT4280001:Vmn2r124 UTSW 17 18063225 missense probably benign 0.22
PIT4514001:Vmn2r124 UTSW 17 18073712 missense probably benign 0.01
R0362:Vmn2r124 UTSW 17 18064224 critical splice donor site probably null
R0401:Vmn2r124 UTSW 17 18064145 missense probably damaging 0.99
R0513:Vmn2r124 UTSW 17 18073729 missense possibly damaging 0.89
R1139:Vmn2r124 UTSW 17 18073790 missense possibly damaging 0.56
R1513:Vmn2r124 UTSW 17 18063273 missense probably damaging 1.00
R1669:Vmn2r124 UTSW 17 18062944 missense possibly damaging 0.94
R1710:Vmn2r124 UTSW 17 18061925 splice site probably benign
R1852:Vmn2r124 UTSW 17 18063174 missense probably benign
R1860:Vmn2r124 UTSW 17 18049497 missense probably benign 0.11
R1953:Vmn2r124 UTSW 17 18062860 missense probably benign 0.08
R2233:Vmn2r124 UTSW 17 18049665 missense possibly damaging 0.95
R2234:Vmn2r124 UTSW 17 18049665 missense possibly damaging 0.95
R2235:Vmn2r124 UTSW 17 18049665 missense possibly damaging 0.95
R2397:Vmn2r124 UTSW 17 18049597 missense possibly damaging 0.95
R2519:Vmn2r124 UTSW 17 18074018 missense probably damaging 1.00
R3845:Vmn2r124 UTSW 17 18073691 missense possibly damaging 0.90
R3846:Vmn2r124 UTSW 17 18073691 missense possibly damaging 0.90
R4594:Vmn2r124 UTSW 17 18073969 missense probably damaging 1.00
R4612:Vmn2r124 UTSW 17 18063022 missense probably benign 0.12
R4790:Vmn2r124 UTSW 17 18049593 missense probably damaging 1.00
R4809:Vmn2r124 UTSW 17 18073745 missense probably benign 0.00
R5227:Vmn2r124 UTSW 17 18049557 missense possibly damaging 0.95
R5254:Vmn2r124 UTSW 17 18063077 missense probably benign 0.00
R5609:Vmn2r124 UTSW 17 18073840 missense probably benign
R6181:Vmn2r124 UTSW 17 18073757 missense possibly damaging 0.93
R6271:Vmn2r124 UTSW 17 18062883 missense probably benign 0.01
R7297:Vmn2r124 UTSW 17 18073573 missense probably damaging 1.00
R7397:Vmn2r124 UTSW 17 18062685 missense probably damaging 1.00
R7406:Vmn2r124 UTSW 17 18062044 missense unknown
R7699:Vmn2r124 UTSW 17 18073723 missense probably benign 0.00
R7859:Vmn2r124 UTSW 17 18061950 missense probably damaging 1.00
R8121:Vmn2r124 UTSW 17 18062171 missense probably benign
R8138:Vmn2r124 UTSW 17 18063348 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGACACATCTCTTTCACTTGC -3'
(R):5'- ACAAATGCCACAGCTTAGGAAG -3'

Sequencing Primer
(F):5'- GGACACATCTCTTTCACTTGCCATTG -3'
(R):5'- TGCCACAGCTTAGGAAGATAAATGTC -3'
Posted On2017-10-10