Incidental Mutation 'R6145:Tbc1d24'
ID 488845
Institutional Source Beutler Lab
Gene Symbol Tbc1d24
Ensembl Gene ENSMUSG00000036473
Gene Name TBC1 domain family, member 24
Synonyms C530046L02Rik
MMRRC Submission 044292-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6145 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 24394405-24424536 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 24427203 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 253 (G253V)
Ref Sequence ENSEMBL: ENSMUSP00000024931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024931] [ENSMUST00000040474] [ENSMUST00000097376] [ENSMUST00000167791] [ENSMUST00000201301] [ENSMUST00000201583] [ENSMUST00000201960] [ENSMUST00000201359] [ENSMUST00000202925] [ENSMUST00000201805] [ENSMUST00000168410] [ENSMUST00000201089]
AlphaFold Q3UUG6
Predicted Effect probably damaging
Transcript: ENSMUST00000024931
AA Change: G253V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024931
Gene: ENSMUSG00000036473
AA Change: G253V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
LamNT 34 253 8.83e-89 SMART
EGF_Lam 255 308 3.03e-5 SMART
EGF_Lam 311 371 1.29e-8 SMART
EGF_Lam 374 421 9.83e-14 SMART
C345C 456 571 2.72e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040474
SMART Domains Protein: ENSMUSP00000036458
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097376
SMART Domains Protein: ENSMUSP00000094989
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
TLDc 342 556 7.8e-82 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148704
Predicted Effect probably benign
Transcript: ENSMUST00000167791
SMART Domains Protein: ENSMUSP00000127005
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 8.6e-6 SMART
TLDc 342 556 7.6e-82 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201716
Predicted Effect probably benign
Transcript: ENSMUST00000201301
SMART Domains Protein: ENSMUSP00000143949
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
TLDc 342 556 7.8e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201583
SMART Domains Protein: ENSMUSP00000144097
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TLDc 1 182 5.2e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201960
SMART Domains Protein: ENSMUSP00000144208
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201359
SMART Domains Protein: ENSMUSP00000144026
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
Blast:TLDc 283 321 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000202925
SMART Domains Protein: ENSMUSP00000144575
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201805
SMART Domains Protein: ENSMUSP00000143883
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
TLDc 342 556 7.8e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168410
SMART Domains Protein: ENSMUSP00000128868
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201089
SMART Domains Protein: ENSMUSP00000144250
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a conserved domain, referred to as the TBC domain, characteristic of proteins which interact with GTPases. TBC domain proteins may serve as GTPase-activating proteins for a particular group of GTPases, the Rab (Ras-related proteins in brain) small GTPases which are involved in the regulation of membrane trafficking. Mutations in this gene are associated with familial infantile myoclonic epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 85,980,664 (GRCm39) probably null Het
Abca8b A G 11: 109,864,634 (GRCm39) V316A probably benign Het
Acad10 A T 5: 121,760,096 (GRCm39) V999D probably damaging Het
Acot8 A G 2: 164,644,985 (GRCm39) V66A probably benign Het
Ankrd11 T C 8: 123,619,400 (GRCm39) H1484R probably damaging Het
Anxa6 A G 11: 54,885,730 (GRCm39) F405S probably damaging Het
Asmt G A X: 169,108,398 (GRCm39) V101I probably damaging Het
Atp1a2 C T 1: 172,114,805 (GRCm39) V327I probably damaging Het
Brdt A G 5: 107,525,865 (GRCm39) E906G possibly damaging Het
Cacna1g A T 11: 94,353,087 (GRCm39) C313S probably damaging Het
Camk2d T C 3: 126,599,507 (GRCm39) I329T probably benign Het
Cavin4 A T 4: 48,663,794 (GRCm39) H58L probably damaging Het
Ccdc78 C A 17: 26,008,039 (GRCm39) P317T probably benign Het
Cdc16 T G 8: 13,817,573 (GRCm39) Y295D possibly damaging Het
Cdyl2 T A 8: 117,321,717 (GRCm39) N270I probably damaging Het
Cfap221 T A 1: 119,912,546 (GRCm39) I114F possibly damaging Het
Dmxl1 A G 18: 50,045,833 (GRCm39) E2414G possibly damaging Het
Dnaaf9 T C 2: 130,620,393 (GRCm39) I247V probably benign Het
Dnah1 C A 14: 31,022,927 (GRCm39) R1070L probably benign Het
Dnah14 T C 1: 181,493,982 (GRCm39) S1713P probably benign Het
Dock10 C A 1: 80,553,621 (GRCm39) G602* probably null Het
Ep400 A T 5: 110,904,569 (GRCm39) V10D possibly damaging Het
Epas1 T C 17: 87,136,857 (GRCm39) C807R probably benign Het
Esrrb C T 12: 86,552,673 (GRCm39) P200L probably benign Het
Fbxw26 T C 9: 109,561,691 (GRCm39) I168V probably benign Het
Fsip2 A T 2: 82,824,112 (GRCm39) H6615L possibly damaging Het
Galk2 A T 2: 125,788,762 (GRCm39) Q272L possibly damaging Het
Gas7 A C 11: 67,520,438 (GRCm39) T43P probably damaging Het
Gm5134 A T 10: 75,831,673 (GRCm39) I371F probably damaging Het
Gpr31b C T 17: 13,270,266 (GRCm39) R301Q possibly damaging Het
Grk1 T A 8: 13,455,765 (GRCm39) Y216* probably null Het
Grm5 T A 7: 87,675,809 (GRCm39) M441K probably damaging Het
Heatr6 A G 11: 83,656,962 (GRCm39) E408G probably damaging Het
Hoxc9 G T 15: 102,892,391 (GRCm39) K201N probably damaging Het
Igsf10 T A 3: 59,239,077 (GRCm39) Y368F possibly damaging Het
Il2ra A T 2: 11,685,057 (GRCm39) D131V probably damaging Het
Imp4 A G 1: 34,479,177 (GRCm39) E19G probably benign Het
Kcnk18 T C 19: 59,224,039 (GRCm39) *395Q probably null Het
Kdm6b A T 11: 69,295,852 (GRCm39) L805Q unknown Het
Lgr4 T A 2: 109,837,588 (GRCm39) L427* probably null Het
Myt1l G A 12: 29,882,380 (GRCm39) S525N unknown Het
Nasp G A 4: 116,468,274 (GRCm39) T237I probably benign Het
Nell2 G T 15: 95,371,442 (GRCm39) Q98K probably damaging Het
Nfasc C T 1: 132,562,455 (GRCm39) G107R probably damaging Het
Nsun4 A G 4: 115,897,403 (GRCm39) S203P probably damaging Het
Or1m1 T G 9: 18,666,865 (GRCm39) D22A probably benign Het
Or7g35 T C 9: 19,496,184 (GRCm39) V117A probably benign Het
Otogl G A 10: 107,612,978 (GRCm39) silent Het
Pde10a T C 17: 9,147,949 (GRCm39) V366A probably damaging Het
Pdxk T A 10: 78,279,625 (GRCm39) D250V probably benign Het
Pih1d1 T A 7: 44,808,468 (GRCm39) I179N probably damaging Het
Plaa T A 4: 94,472,229 (GRCm39) I294F probably damaging Het
Pmel C A 10: 128,551,804 (GRCm39) P213T probably damaging Het
Pom121l2 A T 13: 22,166,472 (GRCm39) R248* probably null Het
Pou2f1 T C 1: 165,703,002 (GRCm39) probably benign Het
Ppm1j G A 3: 104,688,695 (GRCm39) R98H probably damaging Het
Prkdc C T 16: 15,589,937 (GRCm39) P2600L probably damaging Het
Prom1 T C 5: 44,186,991 (GRCm39) N422S probably benign Het
Pspn C T 17: 57,306,467 (GRCm39) C154Y probably damaging Het
Ptdss1 T C 13: 67,120,701 (GRCm39) probably null Het
Rapgef1 A G 2: 29,626,678 (GRCm39) Y993C probably damaging Het
Scrn2 A C 11: 96,923,679 (GRCm39) T219P probably benign Het
Sec23ip T G 7: 128,380,208 (GRCm39) S874R probably damaging Het
Septin4 G A 11: 87,476,072 (GRCm39) probably null Het
Slc15a3 C T 19: 10,834,615 (GRCm39) L499F probably damaging Het
Spaca9 G A 2: 28,583,793 (GRCm39) R64W probably damaging Het
Sra1 A G 18: 36,800,628 (GRCm39) M193T probably damaging Het
Srsf4 G T 4: 131,627,605 (GRCm39) probably benign Het
Syne1 T C 10: 5,002,750 (GRCm39) D8055G probably damaging Het
Syne4 T A 7: 30,015,988 (GRCm39) probably null Het
Tbck T A 3: 132,437,976 (GRCm39) I467N probably damaging Het
Tln1 T A 4: 43,538,030 (GRCm39) M1857L possibly damaging Het
Ttll2 T C 17: 7,619,031 (GRCm39) R299G probably benign Het
Ugt2b36 T G 5: 87,214,072 (GRCm39) E524A probably benign Het
Vmn2r124 C T 17: 18,283,113 (GRCm39) T269I probably benign Het
Vmn2r4 A G 3: 64,314,364 (GRCm39) F206L probably benign Het
Zfp346 A G 13: 55,263,387 (GRCm39) K156R probably damaging Het
Other mutations in Tbc1d24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Tbc1d24 APN 17 24,404,802 (GRCm39) missense probably damaging 1.00
IGL01511:Tbc1d24 APN 17 24,400,892 (GRCm39) missense probably benign 0.00
IGL02499:Tbc1d24 APN 17 24,426,593 (GRCm39) splice site probably null
IGL02706:Tbc1d24 APN 17 24,404,395 (GRCm39) missense probably benign 0.32
R1464:Tbc1d24 UTSW 17 24,400,197 (GRCm39) critical splice donor site probably null
R1464:Tbc1d24 UTSW 17 24,400,197 (GRCm39) critical splice donor site probably null
R1529:Tbc1d24 UTSW 17 24,404,953 (GRCm39) missense probably damaging 1.00
R1985:Tbc1d24 UTSW 17 24,426,938 (GRCm39) nonsense probably null
R1987:Tbc1d24 UTSW 17 24,425,846 (GRCm39) missense possibly damaging 0.94
R2425:Tbc1d24 UTSW 17 24,404,982 (GRCm39) missense probably damaging 0.99
R2902:Tbc1d24 UTSW 17 24,426,220 (GRCm39) missense probably benign 0.01
R4622:Tbc1d24 UTSW 17 24,427,865 (GRCm39) missense probably benign 0.03
R4946:Tbc1d24 UTSW 17 24,427,510 (GRCm39) missense possibly damaging 0.94
R5428:Tbc1d24 UTSW 17 24,400,746 (GRCm39) missense probably benign 0.34
R5890:Tbc1d24 UTSW 17 24,404,500 (GRCm39) missense probably damaging 1.00
R5991:Tbc1d24 UTSW 17 24,428,043 (GRCm39) unclassified probably benign
R6002:Tbc1d24 UTSW 17 24,402,761 (GRCm39) start codon destroyed probably null 1.00
R6245:Tbc1d24 UTSW 17 24,404,967 (GRCm39) missense probably damaging 1.00
R6399:Tbc1d24 UTSW 17 24,427,303 (GRCm39) missense probably damaging 0.97
R6764:Tbc1d24 UTSW 17 24,404,754 (GRCm39) missense possibly damaging 0.95
R6893:Tbc1d24 UTSW 17 24,401,492 (GRCm39) missense probably damaging 1.00
R7219:Tbc1d24 UTSW 17 24,404,266 (GRCm39) missense probably damaging 1.00
R7262:Tbc1d24 UTSW 17 24,426,820 (GRCm39) missense probably damaging 1.00
R7490:Tbc1d24 UTSW 17 24,401,494 (GRCm39) missense probably damaging 1.00
R8013:Tbc1d24 UTSW 17 24,401,795 (GRCm39) missense possibly damaging 0.64
R8014:Tbc1d24 UTSW 17 24,401,795 (GRCm39) missense possibly damaging 0.64
R8558:Tbc1d24 UTSW 17 24,427,903 (GRCm39) missense unknown
R9036:Tbc1d24 UTSW 17 24,427,491 (GRCm39) missense probably benign 0.04
R9050:Tbc1d24 UTSW 17 24,404,899 (GRCm39) missense probably benign 0.38
R9050:Tbc1d24 UTSW 17 24,404,898 (GRCm39) missense possibly damaging 0.75
R9094:Tbc1d24 UTSW 17 24,400,274 (GRCm39) nonsense probably null
R9276:Tbc1d24 UTSW 17 24,405,114 (GRCm39) missense probably damaging 1.00
R9338:Tbc1d24 UTSW 17 24,427,377 (GRCm39) missense probably benign 0.02
R9425:Tbc1d24 UTSW 17 24,404,382 (GRCm39) missense probably benign
Z1176:Tbc1d24 UTSW 17 24,425,780 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGTTGAAGCGGCATCTTCG -3'
(R):5'- TTCAGTGTGCAGGATGGCAG -3'

Sequencing Primer
(F):5'- GTCAGAAGTCCCCAGGCTAC -3'
(R):5'- AGGATGGCAGCCCACAG -3'
Posted On 2017-10-10