Incidental Mutation 'R6145:Sra1'
ID488849
Institutional Source Beutler Lab
Gene Symbol Sra1
Ensembl Gene ENSMUSG00000006050
Gene Namesteroid receptor RNA activator 1
SynonymsSrap
MMRRC Submission 044292-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6145 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location36666681-36679366 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36667575 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 193 (M193T)
Ref Sequence ENSEMBL: ENSMUSP00000133360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001415] [ENSMUST00000036765] [ENSMUST00000142977] [ENSMUST00000173875]
PDB Structure
Solution structure of mouse Steroid receptor RNA activator 1 (SRA1) protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000001415
SMART Domains Protein: ENSMUSP00000001415
Gene: ENSMUSG00000006050

DomainStartEndE-ValueType
WW 30 61 1.72e-7 SMART
low complexity region 85 100 N/A INTRINSIC
PTB 114 260 7.64e-37 SMART
PTB 286 420 4.07e-32 SMART
low complexity region 444 468 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000006209
AA Change: M183T
SMART Domains Protein: ENSMUSP00000006209
Gene: ENSMUSG00000006050
AA Change: M183T

DomainStartEndE-ValueType
Pfam:SRA1 65 208 1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036765
SMART Domains Protein: ENSMUSP00000039298
Gene: ENSMUSG00000090264

DomainStartEndE-ValueType
Pfam:eIF_4EBP 3 101 4.8e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140061
SMART Domains Protein: ENSMUSP00000121811
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
low complexity region 77 94 N/A INTRINSIC
low complexity region 355 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142977
SMART Domains Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173202
Predicted Effect probably benign
Transcript: ENSMUST00000173482
Predicted Effect probably damaging
Transcript: ENSMUST00000173875
AA Change: M193T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133360
Gene: ENSMUSG00000006050
AA Change: M193T

DomainStartEndE-ValueType
Pfam:SRA1 72 217 1.1e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174125
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Both long non-coding and protein-coding RNAs are transcribed from this gene, and they represent alternatively spliced transcript variants. This gene was initially defined as a non-coding RNA, which is a coactivator for several nuclear receptors (NRs) and is associated with breast cancer. It has now been found that this gene is involved in the regulation of many NR and non-NR activities, including metabolism, adipogenesis and chromatin organization. The long non-coding RNA transcripts interact with a variety of proteins, including the protein encoded by this gene. The encoded protein acts as a transcriptional repressor by binding to the non-coding RNA. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous null mice are protected against diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 86,052,942 probably null Het
4930402H24Rik T C 2: 130,778,473 I247V probably benign Het
Abca8b A G 11: 109,973,808 V316A probably benign Het
Acad10 A T 5: 121,622,033 V999D probably damaging Het
Acot8 A G 2: 164,803,065 V66A probably benign Het
Ankrd11 T C 8: 122,892,661 H1484R probably damaging Het
Anxa6 A G 11: 54,994,904 F405S probably damaging Het
Asmt G A X: 170,674,663 V101I probably damaging Het
Atp1a2 C T 1: 172,287,238 V327I probably damaging Het
Brdt A G 5: 107,377,999 E906G possibly damaging Het
Cacna1g A T 11: 94,462,261 C313S probably damaging Het
Camk2d T C 3: 126,805,858 I329T probably benign Het
Cavin4 A T 4: 48,663,794 H58L probably damaging Het
Ccdc78 C A 17: 25,789,065 P317T probably benign Het
Cdc16 T G 8: 13,767,573 Y295D possibly damaging Het
Cdyl2 T A 8: 116,594,978 N270I probably damaging Het
Cfap221 T A 1: 119,984,816 I114F possibly damaging Het
Dmxl1 A G 18: 49,912,766 E2414G possibly damaging Het
Dnah1 C A 14: 31,300,970 R1070L probably benign Het
Dnah14 T C 1: 181,666,417 S1713P probably benign Het
Dock10 C A 1: 80,575,904 G602* probably null Het
Ep400 A T 5: 110,756,703 V10D possibly damaging Het
Epas1 T C 17: 86,829,429 C807R probably benign Het
Esrrb C T 12: 86,505,899 P200L probably benign Het
Fbxw26 T C 9: 109,732,623 I168V probably benign Het
Fsip2 A T 2: 82,993,768 H6615L possibly damaging Het
Galk2 A T 2: 125,946,842 Q272L possibly damaging Het
Gas7 A C 11: 67,629,612 T43P probably damaging Het
Gm5134 A T 10: 75,995,839 I371F probably damaging Het
Gpr31b C T 17: 13,051,379 R301Q possibly damaging Het
Grk1 T A 8: 13,405,765 Y216* probably null Het
Grm5 T A 7: 88,026,601 M441K probably damaging Het
Heatr6 A G 11: 83,766,136 E408G probably damaging Het
Hoxc9 G T 15: 102,983,959 K201N probably damaging Het
Igsf10 T A 3: 59,331,656 Y368F possibly damaging Het
Il2ra A T 2: 11,680,246 D131V probably damaging Het
Imp4 A G 1: 34,440,096 E19G probably benign Het
Kcnk18 T C 19: 59,235,607 *395Q probably null Het
Kdm6b A T 11: 69,405,026 L805Q unknown Het
Lgr4 T A 2: 110,007,243 L427* probably null Het
Myt1l G A 12: 29,832,381 S525N unknown Het
Nasp G A 4: 116,611,077 T237I probably benign Het
Nell2 G T 15: 95,473,561 Q98K probably damaging Het
Nfasc C T 1: 132,634,717 G107R probably damaging Het
Nsun4 A G 4: 116,040,206 S203P probably damaging Het
Olfr24 T G 9: 18,755,569 D22A probably benign Het
Olfr855 T C 9: 19,584,888 V117A probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pde10a T C 17: 8,929,117 V366A probably damaging Het
Pdxk T A 10: 78,443,791 D250V probably benign Het
Pih1d1 T A 7: 45,159,044 I179N probably damaging Het
Plaa T A 4: 94,583,992 I294F probably damaging Het
Pmel C A 10: 128,715,935 P213T probably damaging Het
Pom121l2 A T 13: 21,982,302 R248* probably null Het
Pou2f1 T C 1: 165,875,433 probably benign Het
Ppm1j G A 3: 104,781,379 R98H probably damaging Het
Prkdc C T 16: 15,772,073 P2600L probably damaging Het
Prom1 T C 5: 44,029,649 N422S probably benign Het
Pspn C T 17: 56,999,467 C154Y probably damaging Het
Ptdss1 T C 13: 66,972,637 probably null Het
Rapgef1 A G 2: 29,736,666 Y993C probably damaging Het
Scrn2 A C 11: 97,032,853 T219P probably benign Het
Sec23ip T G 7: 128,778,484 S874R probably damaging Het
Sept4 G A 11: 87,585,246 probably null Het
Slc15a3 C T 19: 10,857,251 L499F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Srsf4 G T 4: 131,900,294 probably benign Het
Syne1 T C 10: 5,052,750 D8055G probably damaging Het
Syne4 T A 7: 30,316,563 probably null Het
Tbc1d24 C A 17: 24,208,229 G253V probably damaging Het
Tbck T A 3: 132,732,215 I467N probably damaging Het
Tln1 T A 4: 43,538,030 M1857L possibly damaging Het
Ttll2 T C 17: 7,351,632 R299G probably benign Het
Ugt2b36 T G 5: 87,066,213 E524A probably benign Het
Vmn2r124 C T 17: 18,062,851 T269I probably benign Het
Vmn2r4 A G 3: 64,406,943 F206L probably benign Het
Zfp346 A G 13: 55,115,574 K156R probably damaging Het
Other mutations in Sra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Sra1 APN 18 36668739 missense probably benign 0.36
IGL01390:Sra1 APN 18 36670081 missense probably damaging 1.00
IGL01645:Sra1 APN 18 36671473 missense probably damaging 1.00
IGL02478:Sra1 APN 18 36668792 missense probably benign 0.00
IGL02578:Sra1 APN 18 36670097 nonsense probably null
R0218:Sra1 UTSW 18 36676609 unclassified probably benign
R0243:Sra1 UTSW 18 36675706 nonsense probably null
R0432:Sra1 UTSW 18 36677503 missense probably benign
R0834:Sra1 UTSW 18 36668776 missense probably benign 0.00
R1886:Sra1 UTSW 18 36668777 missense probably benign
R2105:Sra1 UTSW 18 36675068 missense probably benign 0.00
R2911:Sra1 UTSW 18 36676185 missense possibly damaging 0.49
R4951:Sra1 UTSW 18 36676441 nonsense probably null
R5034:Sra1 UTSW 18 36678995 critical splice donor site probably null
R5091:Sra1 UTSW 18 36669959 intron probably benign
R5122:Sra1 UTSW 18 36667594 missense probably benign 0.03
R5656:Sra1 UTSW 18 36678407 missense probably damaging 0.99
R5722:Sra1 UTSW 18 36674978 missense probably damaging 1.00
R5726:Sra1 UTSW 18 36670173 intron probably benign
R5729:Sra1 UTSW 18 36667443 utr 3 prime probably benign
R5937:Sra1 UTSW 18 36671599 unclassified probably null
R6161:Sra1 UTSW 18 36670283 missense probably damaging 0.99
R7423:Sra1 UTSW 18 36667483 missense probably benign 0.00
R8074:Sra1 UTSW 18 36675011 missense possibly damaging 0.89
R8100:Sra1 UTSW 18 36676895 missense probably damaging 1.00
Z1176:Sra1 UTSW 18 36670009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAATAGTCTCCCTGGTGG -3'
(R):5'- TCCCATTGATGGCTGAATTGG -3'

Sequencing Primer
(F):5'- CCAATAGTCTCCCTGGTGGTAAAAAG -3'
(R):5'- CTGAATTGGTGGCAAGGTTTTAAC -3'
Posted On2017-10-10