Incidental Mutation 'R6145:Dmxl1'
ID 488850
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene Name Dmx-like 1
Synonyms C630007L23Rik
MMRRC Submission 044292-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.953) question?
Stock # R6145 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 49832670-49965473 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49912766 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2414 (E2414G)
Ref Sequence ENSEMBL: ENSMUSP00000137871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000041772
AA Change: E2426G

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: E2426G

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000180611
AA Change: E2414G

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: E2414G

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181907
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 86,052,942 (GRCm38) probably null Het
4930402H24Rik T C 2: 130,778,473 (GRCm38) I247V probably benign Het
Abca8b A G 11: 109,973,808 (GRCm38) V316A probably benign Het
Acad10 A T 5: 121,622,033 (GRCm38) V999D probably damaging Het
Acot8 A G 2: 164,803,065 (GRCm38) V66A probably benign Het
Ankrd11 T C 8: 122,892,661 (GRCm38) H1484R probably damaging Het
Anxa6 A G 11: 54,994,904 (GRCm38) F405S probably damaging Het
Asmt G A X: 170,674,663 (GRCm38) V101I probably damaging Het
Atp1a2 C T 1: 172,287,238 (GRCm38) V327I probably damaging Het
Brdt A G 5: 107,377,999 (GRCm38) E906G possibly damaging Het
Cacna1g A T 11: 94,462,261 (GRCm38) C313S probably damaging Het
Camk2d T C 3: 126,805,858 (GRCm38) I329T probably benign Het
Cavin4 A T 4: 48,663,794 (GRCm38) H58L probably damaging Het
Ccdc78 C A 17: 25,789,065 (GRCm38) P317T probably benign Het
Cdc16 T G 8: 13,767,573 (GRCm38) Y295D possibly damaging Het
Cdyl2 T A 8: 116,594,978 (GRCm38) N270I probably damaging Het
Cfap221 T A 1: 119,984,816 (GRCm38) I114F possibly damaging Het
Dnah1 C A 14: 31,300,970 (GRCm38) R1070L probably benign Het
Dnah14 T C 1: 181,666,417 (GRCm38) S1713P probably benign Het
Dock10 C A 1: 80,575,904 (GRCm38) G602* probably null Het
Ep400 A T 5: 110,756,703 (GRCm38) V10D possibly damaging Het
Epas1 T C 17: 86,829,429 (GRCm38) C807R probably benign Het
Esrrb C T 12: 86,505,899 (GRCm38) P200L probably benign Het
Fbxw26 T C 9: 109,732,623 (GRCm38) I168V probably benign Het
Fsip2 A T 2: 82,993,768 (GRCm38) H6615L possibly damaging Het
Galk2 A T 2: 125,946,842 (GRCm38) Q272L possibly damaging Het
Gas7 A C 11: 67,629,612 (GRCm38) T43P probably damaging Het
Gm5134 A T 10: 75,995,839 (GRCm38) I371F probably damaging Het
Gpr31b C T 17: 13,051,379 (GRCm38) R301Q possibly damaging Het
Grk1 T A 8: 13,405,765 (GRCm38) Y216* probably null Het
Grm5 T A 7: 88,026,601 (GRCm38) M441K probably damaging Het
Heatr6 A G 11: 83,766,136 (GRCm38) E408G probably damaging Het
Hoxc9 G T 15: 102,983,959 (GRCm38) K201N probably damaging Het
Igsf10 T A 3: 59,331,656 (GRCm38) Y368F possibly damaging Het
Il2ra A T 2: 11,680,246 (GRCm38) D131V probably damaging Het
Imp4 A G 1: 34,440,096 (GRCm38) E19G probably benign Het
Kcnk18 T C 19: 59,235,607 (GRCm38) *395Q probably null Het
Kdm6b A T 11: 69,405,026 (GRCm38) L805Q unknown Het
Lgr4 T A 2: 110,007,243 (GRCm38) L427* probably null Het
Myt1l G A 12: 29,832,381 (GRCm38) S525N unknown Het
Nasp G A 4: 116,611,077 (GRCm38) T237I probably benign Het
Nell2 G T 15: 95,473,561 (GRCm38) Q98K probably damaging Het
Nfasc C T 1: 132,634,717 (GRCm38) G107R probably damaging Het
Nsun4 A G 4: 116,040,206 (GRCm38) S203P probably damaging Het
Olfr24 T G 9: 18,755,569 (GRCm38) D22A probably benign Het
Olfr855 T C 9: 19,584,888 (GRCm38) V117A probably benign Het
Otogl G A 10: 107,777,117 (GRCm38) silent Het
Pde10a T C 17: 8,929,117 (GRCm38) V366A probably damaging Het
Pdxk T A 10: 78,443,791 (GRCm38) D250V probably benign Het
Pih1d1 T A 7: 45,159,044 (GRCm38) I179N probably damaging Het
Plaa T A 4: 94,583,992 (GRCm38) I294F probably damaging Het
Pmel C A 10: 128,715,935 (GRCm38) P213T probably damaging Het
Pom121l2 A T 13: 21,982,302 (GRCm38) R248* probably null Het
Pou2f1 T C 1: 165,875,433 (GRCm38) probably benign Het
Ppm1j G A 3: 104,781,379 (GRCm38) R98H probably damaging Het
Prkdc C T 16: 15,772,073 (GRCm38) P2600L probably damaging Het
Prom1 T C 5: 44,029,649 (GRCm38) N422S probably benign Het
Pspn C T 17: 56,999,467 (GRCm38) C154Y probably damaging Het
Ptdss1 T C 13: 66,972,637 (GRCm38) probably null Het
Rapgef1 A G 2: 29,736,666 (GRCm38) Y993C probably damaging Het
Scrn2 A C 11: 97,032,853 (GRCm38) T219P probably benign Het
Sec23ip T G 7: 128,778,484 (GRCm38) S874R probably damaging Het
Sept4 G A 11: 87,585,246 (GRCm38) probably null Het
Slc15a3 C T 19: 10,857,251 (GRCm38) L499F probably damaging Het
Spaca9 G A 2: 28,693,781 (GRCm38) R64W probably damaging Het
Sra1 A G 18: 36,667,575 (GRCm38) M193T probably damaging Het
Srsf4 G T 4: 131,900,294 (GRCm38) probably benign Het
Syne1 T C 10: 5,052,750 (GRCm38) D8055G probably damaging Het
Syne4 T A 7: 30,316,563 (GRCm38) probably null Het
Tbc1d24 C A 17: 24,208,229 (GRCm38) G253V probably damaging Het
Tbck T A 3: 132,732,215 (GRCm38) I467N probably damaging Het
Tln1 T A 4: 43,538,030 (GRCm38) M1857L possibly damaging Het
Ttll2 T C 17: 7,351,632 (GRCm38) R299G probably benign Het
Ugt2b36 T G 5: 87,066,213 (GRCm38) E524A probably benign Het
Vmn2r124 C T 17: 18,062,851 (GRCm38) T269I probably benign Het
Vmn2r4 A G 3: 64,406,943 (GRCm38) F206L probably benign Het
Zfp346 A G 13: 55,115,574 (GRCm38) K156R probably damaging Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49,851,467 (GRCm38) missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 49,939,553 (GRCm38) missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 49,917,668 (GRCm38) missense probably benign 0.00
IGL00969:Dmxl1 APN 18 49,912,725 (GRCm38) missense probably benign 0.02
IGL01113:Dmxl1 APN 18 49,912,751 (GRCm38) missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49,857,334 (GRCm38) missense probably benign
IGL01475:Dmxl1 APN 18 49,871,714 (GRCm38) missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 49,920,938 (GRCm38) missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 49,962,205 (GRCm38) missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49,863,025 (GRCm38) missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49,864,868 (GRCm38) missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 49,878,382 (GRCm38) nonsense probably null
IGL01933:Dmxl1 APN 18 49,877,785 (GRCm38) missense probably benign 0.17
IGL01952:Dmxl1 APN 18 49,890,654 (GRCm38) missense probably benign 0.11
IGL02120:Dmxl1 APN 18 49,894,178 (GRCm38) missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 49,961,163 (GRCm38) missense probably benign 0.00
IGL02213:Dmxl1 APN 18 49,877,674 (GRCm38) splice site probably benign
IGL02261:Dmxl1 APN 18 49,840,499 (GRCm38) missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49,864,895 (GRCm38) missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49,859,120 (GRCm38) missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 49,878,180 (GRCm38) missense probably benign 0.01
IGL03258:Dmxl1 APN 18 49,920,893 (GRCm38) missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49,864,818 (GRCm38) missense probably benign
capture UTSW 18 49,962,261 (GRCm38) missense probably damaging 1.00
carnivora UTSW 18 49,864,383 (GRCm38) missense probably damaging 0.99
digestion UTSW 18 49,878,259 (GRCm38) missense probably damaging 1.00
drowning UTSW 18 49,878,225 (GRCm38) missense possibly damaging 0.55
hibiscus UTSW 18 49,889,467 (GRCm38) missense probably damaging 1.00
impound UTSW 18 49,893,249 (GRCm38) missense probably benign
pitcher UTSW 18 49,864,148 (GRCm38) missense probably damaging 1.00
PIT4810001:Dmxl1 UTSW 18 49,931,963 (GRCm38) missense probably damaging 1.00
R0001:Dmxl1 UTSW 18 49,888,897 (GRCm38) splice site probably benign
R0027:Dmxl1 UTSW 18 49,957,295 (GRCm38) splice site probably benign
R0042:Dmxl1 UTSW 18 49,864,035 (GRCm38) missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49,864,035 (GRCm38) missense probably benign 0.03
R0046:Dmxl1 UTSW 18 49,878,082 (GRCm38) missense probably benign 0.22
R0046:Dmxl1 UTSW 18 49,878,082 (GRCm38) missense probably benign 0.22
R0257:Dmxl1 UTSW 18 49,955,803 (GRCm38) splice site probably benign
R0349:Dmxl1 UTSW 18 49,879,282 (GRCm38) missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 49,879,362 (GRCm38) missense probably benign 0.14
R0511:Dmxl1 UTSW 18 49,891,467 (GRCm38) nonsense probably null
R0539:Dmxl1 UTSW 18 49,857,430 (GRCm38) splice site probably benign
R0542:Dmxl1 UTSW 18 49,893,694 (GRCm38) missense probably benign 0.05
R0587:Dmxl1 UTSW 18 49,935,307 (GRCm38) missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49,851,423 (GRCm38) splice site probably benign
R0744:Dmxl1 UTSW 18 49,833,148 (GRCm38) missense probably damaging 1.00
R0836:Dmxl1 UTSW 18 49,833,148 (GRCm38) missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 49,893,402 (GRCm38) missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 49,893,611 (GRCm38) missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 49,893,225 (GRCm38) missense probably benign
R1313:Dmxl1 UTSW 18 49,878,483 (GRCm38) missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 49,878,483 (GRCm38) missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 49,888,853 (GRCm38) missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49,857,249 (GRCm38) missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49,852,367 (GRCm38) missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49,859,286 (GRCm38) critical splice donor site probably null
R1638:Dmxl1 UTSW 18 49,890,767 (GRCm38) nonsense probably null
R1646:Dmxl1 UTSW 18 49,962,261 (GRCm38) missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 49,934,637 (GRCm38) missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 49,902,988 (GRCm38) missense probably benign
R1732:Dmxl1 UTSW 18 49,893,444 (GRCm38) nonsense probably null
R1886:Dmxl1 UTSW 18 49,859,135 (GRCm38) missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49,859,135 (GRCm38) missense probably benign 0.09
R1895:Dmxl1 UTSW 18 49,955,914 (GRCm38) splice site probably null
R1911:Dmxl1 UTSW 18 49,878,163 (GRCm38) missense probably benign 0.00
R2020:Dmxl1 UTSW 18 49,889,558 (GRCm38) nonsense probably null
R2116:Dmxl1 UTSW 18 49,878,817 (GRCm38) missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 49,917,631 (GRCm38) missense probably benign 0.00
R2206:Dmxl1 UTSW 18 49,894,094 (GRCm38) missense probably benign 0.12
R2216:Dmxl1 UTSW 18 49,893,923 (GRCm38) missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49,846,639 (GRCm38) missense probably benign 0.34
R2333:Dmxl1 UTSW 18 49,919,976 (GRCm38) splice site probably null
R2343:Dmxl1 UTSW 18 49,890,678 (GRCm38) missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 49,880,791 (GRCm38) missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 49,935,317 (GRCm38) missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 49,935,317 (GRCm38) missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49,865,122 (GRCm38) missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49,865,122 (GRCm38) missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49,865,122 (GRCm38) missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 49,878,259 (GRCm38) missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 49,878,259 (GRCm38) missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 49,878,259 (GRCm38) missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 49,878,259 (GRCm38) missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 49,878,259 (GRCm38) missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49,863,962 (GRCm38) missense probably benign
R4033:Dmxl1 UTSW 18 49,851,431 (GRCm38) missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 49,961,197 (GRCm38) missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 49,878,017 (GRCm38) nonsense probably null
R4406:Dmxl1 UTSW 18 49,889,553 (GRCm38) missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49,848,761 (GRCm38) missense probably benign
R4454:Dmxl1 UTSW 18 49,893,332 (GRCm38) missense probably benign 0.01
R4459:Dmxl1 UTSW 18 49,961,216 (GRCm38) missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49,852,360 (GRCm38) missense probably damaging 1.00
R4570:Dmxl1 UTSW 18 49,852,360 (GRCm38) missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 49,962,181 (GRCm38) missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 49,878,631 (GRCm38) missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 49,878,021 (GRCm38) missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49,862,992 (GRCm38) missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49,851,476 (GRCm38) missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 49,889,467 (GRCm38) missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 49,957,281 (GRCm38) intron probably benign
R4885:Dmxl1 UTSW 18 49,878,795 (GRCm38) missense probably damaging 0.99
R4916:Dmxl1 UTSW 18 49,877,697 (GRCm38) missense probably damaging 1.00
R5022:Dmxl1 UTSW 18 49,895,127 (GRCm38) missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 49,870,923 (GRCm38) missense probably benign 0.00
R5177:Dmxl1 UTSW 18 49,893,584 (GRCm38) missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 49,951,235 (GRCm38) missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49,863,119 (GRCm38) critical splice donor site probably null
R5433:Dmxl1 UTSW 18 49,867,899 (GRCm38) splice site probably null
R5484:Dmxl1 UTSW 18 49,889,464 (GRCm38) missense probably damaging 1.00
R5598:Dmxl1 UTSW 18 49,864,478 (GRCm38) missense probably benign 0.04
R5633:Dmxl1 UTSW 18 49,877,697 (GRCm38) missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 49,891,626 (GRCm38) missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 49,894,257 (GRCm38) missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 49,931,941 (GRCm38) nonsense probably null
R5706:Dmxl1 UTSW 18 49,957,395 (GRCm38) critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49,846,586 (GRCm38) missense probably benign
R5876:Dmxl1 UTSW 18 49,870,984 (GRCm38) missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49,857,386 (GRCm38) missense probably benign 0.00
R6189:Dmxl1 UTSW 18 49,893,335 (GRCm38) missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49,863,015 (GRCm38) missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 49,902,367 (GRCm38) missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 49,871,732 (GRCm38) missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49,846,586 (GRCm38) missense probably benign
R6319:Dmxl1 UTSW 18 49,852,300 (GRCm38) missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49,864,578 (GRCm38) missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49,859,179 (GRCm38) missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 49,878,246 (GRCm38) missense probably benign 0.03
R6743:Dmxl1 UTSW 18 49,880,780 (GRCm38) missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 49,893,974 (GRCm38) missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 49,921,024 (GRCm38) missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 49,921,024 (GRCm38) missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 49,921,024 (GRCm38) missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 49,921,024 (GRCm38) missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 49,955,823 (GRCm38) missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 49,955,823 (GRCm38) missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49,852,288 (GRCm38) nonsense probably null
R6857:Dmxl1 UTSW 18 49,864,835 (GRCm38) missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 49,935,305 (GRCm38) missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49,843,784 (GRCm38) critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 49,920,902 (GRCm38) missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49,863,057 (GRCm38) missense possibly damaging 0.51
R6897:Dmxl1 UTSW 18 49,851,495 (GRCm38) missense probably null 0.99
R6917:Dmxl1 UTSW 18 49,864,148 (GRCm38) missense probably damaging 1.00
R7192:Dmxl1 UTSW 18 49,955,853 (GRCm38) missense probably damaging 0.99
R7447:Dmxl1 UTSW 18 49,864,614 (GRCm38) missense probably damaging 0.99
R7460:Dmxl1 UTSW 18 49,878,612 (GRCm38) missense probably benign 0.00
R7570:Dmxl1 UTSW 18 49,893,957 (GRCm38) missense possibly damaging 0.82
R7626:Dmxl1 UTSW 18 49,902,794 (GRCm38) missense probably benign
R7629:Dmxl1 UTSW 18 49,859,270 (GRCm38) missense probably damaging 1.00
R7644:Dmxl1 UTSW 18 49,893,552 (GRCm38) missense probably benign
R7688:Dmxl1 UTSW 18 49,955,871 (GRCm38) missense probably benign 0.03
R7689:Dmxl1 UTSW 18 49,846,618 (GRCm38) missense probably benign 0.00
R7712:Dmxl1 UTSW 18 49,893,461 (GRCm38) missense probably damaging 0.99
R7808:Dmxl1 UTSW 18 49,878,315 (GRCm38) missense probably benign 0.00
R7834:Dmxl1 UTSW 18 49,920,977 (GRCm38) missense probably damaging 1.00
R7848:Dmxl1 UTSW 18 49,840,490 (GRCm38) missense possibly damaging 0.88
R7849:Dmxl1 UTSW 18 49,961,147 (GRCm38) missense probably benign 0.00
R7881:Dmxl1 UTSW 18 49,864,383 (GRCm38) missense probably damaging 0.99
R7884:Dmxl1 UTSW 18 49,893,407 (GRCm38) missense possibly damaging 0.65
R8073:Dmxl1 UTSW 18 49,878,433 (GRCm38) missense probably damaging 1.00
R8089:Dmxl1 UTSW 18 49,888,830 (GRCm38) missense probably damaging 0.99
R8266:Dmxl1 UTSW 18 49,843,811 (GRCm38) missense probably benign 0.17
R8371:Dmxl1 UTSW 18 49,898,714 (GRCm38) missense probably benign 0.08
R8402:Dmxl1 UTSW 18 49,878,342 (GRCm38) missense probably benign
R8402:Dmxl1 UTSW 18 49,878,326 (GRCm38) nonsense probably null
R8402:Dmxl1 UTSW 18 49,878,327 (GRCm38) missense probably benign 0.09
R8423:Dmxl1 UTSW 18 49,865,116 (GRCm38) missense probably damaging 1.00
R8678:Dmxl1 UTSW 18 49,871,692 (GRCm38) nonsense probably null
R8702:Dmxl1 UTSW 18 49,859,135 (GRCm38) missense probably benign 0.09
R8749:Dmxl1 UTSW 18 49,955,870 (GRCm38) missense probably damaging 1.00
R8813:Dmxl1 UTSW 18 49,957,339 (GRCm38) missense probably damaging 0.99
R8877:Dmxl1 UTSW 18 49,878,225 (GRCm38) missense possibly damaging 0.55
R8945:Dmxl1 UTSW 18 49,939,572 (GRCm38) missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 49,893,674 (GRCm38) missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 49,864,508 (GRCm38) missense possibly damaging 0.96
R8978:Dmxl1 UTSW 18 49,922,612 (GRCm38) missense probably benign 0.37
R8987:Dmxl1 UTSW 18 49,893,852 (GRCm38) missense
R9011:Dmxl1 UTSW 18 49,864,173 (GRCm38) missense probably damaging 1.00
R9124:Dmxl1 UTSW 18 49,939,572 (GRCm38) missense probably damaging 1.00
R9131:Dmxl1 UTSW 18 49,939,572 (GRCm38) missense probably damaging 1.00
R9132:Dmxl1 UTSW 18 49,939,572 (GRCm38) missense probably damaging 1.00
R9156:Dmxl1 UTSW 18 49,939,572 (GRCm38) missense probably damaging 1.00
R9165:Dmxl1 UTSW 18 49,878,925 (GRCm38) missense probably damaging 1.00
R9244:Dmxl1 UTSW 18 49,893,249 (GRCm38) missense probably benign
R9254:Dmxl1 UTSW 18 49,891,500 (GRCm38) missense possibly damaging 0.67
R9262:Dmxl1 UTSW 18 49,843,852 (GRCm38) missense probably benign 0.03
R9335:Dmxl1 UTSW 18 49,859,120 (GRCm38) missense probably damaging 0.96
R9375:Dmxl1 UTSW 18 49,958,410 (GRCm38) missense probably damaging 1.00
R9379:Dmxl1 UTSW 18 49,891,500 (GRCm38) missense possibly damaging 0.67
R9434:Dmxl1 UTSW 18 49,877,721 (GRCm38) missense probably damaging 0.98
R9470:Dmxl1 UTSW 18 49,893,710 (GRCm38) missense possibly damaging 0.69
R9500:Dmxl1 UTSW 18 49,878,204 (GRCm38) missense probably damaging 1.00
R9507:Dmxl1 UTSW 18 49,891,500 (GRCm38) missense possibly damaging 0.94
R9617:Dmxl1 UTSW 18 49,865,161 (GRCm38) missense probably damaging 1.00
R9642:Dmxl1 UTSW 18 49,880,758 (GRCm38) missense probably damaging 1.00
RF009:Dmxl1 UTSW 18 49,893,394 (GRCm38) missense probably damaging 0.96
X0025:Dmxl1 UTSW 18 49,864,368 (GRCm38) missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 49,919,899 (GRCm38) missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 49,920,965 (GRCm38) missense probably benign
Z1188:Dmxl1 UTSW 18 49,868,003 (GRCm38) missense probably damaging 0.96
Z1189:Dmxl1 UTSW 18 49,868,003 (GRCm38) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGAGATGGTTTGCCTCCTTCC -3'
(R):5'- GTTTGAAGTGGAGAGTCCTAATATG -3'

Sequencing Primer
(F):5'- AGCTTTTGTATCCTATTCGTAGTTAC -3'
(R):5'- GAAGTACCAAGAGCTAACCAT -3'
Posted On 2017-10-10