Incidental Mutation 'R6145:Kcnk18'
ID 488852
Institutional Source Beutler Lab
Gene Symbol Kcnk18
Ensembl Gene ENSMUSG00000040901
Gene Name potassium channel, subfamily K, member 18
Synonyms LOC332396, Tresk, Tresk-2
MMRRC Submission 044292-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6145 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 59219648-59237370 bp(+) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) T to C at 59235607 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Glutamine at position 395 (*395Q)
Ref Sequence ENSEMBL: ENSMUSP00000065713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065204]
AlphaFold Q6VV64
Predicted Effect probably null
Transcript: ENSMUST00000065204
AA Change: *395Q
SMART Domains Protein: ENSMUSP00000065713
Gene: ENSMUSG00000040901
AA Change: *395Q

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
Pfam:Ion_trans_2 99 168 1e-21 PFAM
Pfam:Ion_trans_2 298 376 1.4e-14 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels play a role in many cellular processes including maintenance of the action potential, muscle contraction, hormone secretion, osmotic regulation, and ion flow. This gene encodes a member of the superfamily of potassium channel proteins containing two pore-forming P domains and the encoded protein functions as an outward rectifying potassium channel. A mutation in this gene has been found to be associated with migraine with aura.[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit altered potassium conductance and neuron electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 86,052,942 (GRCm38) probably null Het
Abca8b A G 11: 109,973,808 (GRCm38) V316A probably benign Het
Acad10 A T 5: 121,622,033 (GRCm38) V999D probably damaging Het
Acot8 A G 2: 164,803,065 (GRCm38) V66A probably benign Het
Ankrd11 T C 8: 122,892,661 (GRCm38) H1484R probably damaging Het
Anxa6 A G 11: 54,994,904 (GRCm38) F405S probably damaging Het
Asmt G A X: 170,674,663 (GRCm38) V101I probably damaging Het
Atp1a2 C T 1: 172,287,238 (GRCm38) V327I probably damaging Het
Brdt A G 5: 107,377,999 (GRCm38) E906G possibly damaging Het
Cacna1g A T 11: 94,462,261 (GRCm38) C313S probably damaging Het
Camk2d T C 3: 126,805,858 (GRCm38) I329T probably benign Het
Cavin4 A T 4: 48,663,794 (GRCm38) H58L probably damaging Het
Ccdc78 C A 17: 25,789,065 (GRCm38) P317T probably benign Het
Cdc16 T G 8: 13,767,573 (GRCm38) Y295D possibly damaging Het
Cdyl2 T A 8: 116,594,978 (GRCm38) N270I probably damaging Het
Cfap221 T A 1: 119,984,816 (GRCm38) I114F possibly damaging Het
Dmxl1 A G 18: 49,912,766 (GRCm38) E2414G possibly damaging Het
Dnaaf9 T C 2: 130,778,473 (GRCm38) I247V probably benign Het
Dnah1 C A 14: 31,300,970 (GRCm38) R1070L probably benign Het
Dnah14 T C 1: 181,666,417 (GRCm38) S1713P probably benign Het
Dock10 C A 1: 80,575,904 (GRCm38) G602* probably null Het
Ep400 A T 5: 110,756,703 (GRCm38) V10D possibly damaging Het
Epas1 T C 17: 86,829,429 (GRCm38) C807R probably benign Het
Esrrb C T 12: 86,505,899 (GRCm38) P200L probably benign Het
Fbxw26 T C 9: 109,732,623 (GRCm38) I168V probably benign Het
Fsip2 A T 2: 82,993,768 (GRCm38) H6615L possibly damaging Het
Galk2 A T 2: 125,946,842 (GRCm38) Q272L possibly damaging Het
Gas7 A C 11: 67,629,612 (GRCm38) T43P probably damaging Het
Gm5134 A T 10: 75,995,839 (GRCm38) I371F probably damaging Het
Gpr31b C T 17: 13,051,379 (GRCm38) R301Q possibly damaging Het
Grk1 T A 8: 13,405,765 (GRCm38) Y216* probably null Het
Grm5 T A 7: 88,026,601 (GRCm38) M441K probably damaging Het
Heatr6 A G 11: 83,766,136 (GRCm38) E408G probably damaging Het
Hoxc9 G T 15: 102,983,959 (GRCm38) K201N probably damaging Het
Igsf10 T A 3: 59,331,656 (GRCm38) Y368F possibly damaging Het
Il2ra A T 2: 11,680,246 (GRCm38) D131V probably damaging Het
Imp4 A G 1: 34,440,096 (GRCm38) E19G probably benign Het
Kdm6b A T 11: 69,405,026 (GRCm38) L805Q unknown Het
Lgr4 T A 2: 110,007,243 (GRCm38) L427* probably null Het
Myt1l G A 12: 29,832,381 (GRCm38) S525N unknown Het
Nasp G A 4: 116,611,077 (GRCm38) T237I probably benign Het
Nell2 G T 15: 95,473,561 (GRCm38) Q98K probably damaging Het
Nfasc C T 1: 132,634,717 (GRCm38) G107R probably damaging Het
Nsun4 A G 4: 116,040,206 (GRCm38) S203P probably damaging Het
Or1m1 T G 9: 18,755,569 (GRCm38) D22A probably benign Het
Or7g35 T C 9: 19,584,888 (GRCm38) V117A probably benign Het
Otogl G A 10: 107,777,117 (GRCm38) silent Het
Pde10a T C 17: 8,929,117 (GRCm38) V366A probably damaging Het
Pdxk T A 10: 78,443,791 (GRCm38) D250V probably benign Het
Pih1d1 T A 7: 45,159,044 (GRCm38) I179N probably damaging Het
Plaa T A 4: 94,583,992 (GRCm38) I294F probably damaging Het
Pmel C A 10: 128,715,935 (GRCm38) P213T probably damaging Het
Pom121l2 A T 13: 21,982,302 (GRCm38) R248* probably null Het
Pou2f1 T C 1: 165,875,433 (GRCm38) probably benign Het
Ppm1j G A 3: 104,781,379 (GRCm38) R98H probably damaging Het
Prkdc C T 16: 15,772,073 (GRCm38) P2600L probably damaging Het
Prom1 T C 5: 44,029,649 (GRCm38) N422S probably benign Het
Pspn C T 17: 56,999,467 (GRCm38) C154Y probably damaging Het
Ptdss1 T C 13: 66,972,637 (GRCm38) probably null Het
Rapgef1 A G 2: 29,736,666 (GRCm38) Y993C probably damaging Het
Scrn2 A C 11: 97,032,853 (GRCm38) T219P probably benign Het
Sec23ip T G 7: 128,778,484 (GRCm38) S874R probably damaging Het
Septin4 G A 11: 87,585,246 (GRCm38) probably null Het
Slc15a3 C T 19: 10,857,251 (GRCm38) L499F probably damaging Het
Spaca9 G A 2: 28,693,781 (GRCm38) R64W probably damaging Het
Sra1 A G 18: 36,667,575 (GRCm38) M193T probably damaging Het
Srsf4 G T 4: 131,900,294 (GRCm38) probably benign Het
Syne1 T C 10: 5,052,750 (GRCm38) D8055G probably damaging Het
Syne4 T A 7: 30,316,563 (GRCm38) probably null Het
Tbc1d24 C A 17: 24,208,229 (GRCm38) G253V probably damaging Het
Tbck T A 3: 132,732,215 (GRCm38) I467N probably damaging Het
Tln1 T A 4: 43,538,030 (GRCm38) M1857L possibly damaging Het
Ttll2 T C 17: 7,351,632 (GRCm38) R299G probably benign Het
Ugt2b36 T G 5: 87,066,213 (GRCm38) E524A probably benign Het
Vmn2r124 C T 17: 18,062,851 (GRCm38) T269I probably benign Het
Vmn2r4 A G 3: 64,406,943 (GRCm38) F206L probably benign Het
Zfp346 A G 13: 55,115,574 (GRCm38) K156R probably damaging Het
Other mutations in Kcnk18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Kcnk18 APN 19 59,235,070 (GRCm38) missense probably benign 0.23
IGL01460:Kcnk18 APN 19 59,219,857 (GRCm38) missense probably damaging 1.00
IGL02054:Kcnk18 APN 19 59,235,613 (GRCm38) utr 3 prime probably benign
IGL02304:Kcnk18 APN 19 59,234,863 (GRCm38) missense probably damaging 1.00
IGL02499:Kcnk18 APN 19 59,235,182 (GRCm38) missense probably benign 0.10
IGL02527:Kcnk18 APN 19 59,235,275 (GRCm38) missense probably damaging 0.99
IGL03033:Kcnk18 APN 19 59,235,184 (GRCm38) missense probably benign 0.21
cedar UTSW 19 59,235,341 (GRCm38) missense probably damaging 1.00
R1552:Kcnk18 UTSW 19 59,235,458 (GRCm38) missense probably damaging 0.99
R1775:Kcnk18 UTSW 19 59,235,341 (GRCm38) missense probably damaging 1.00
R1913:Kcnk18 UTSW 19 59,235,058 (GRCm38) missense possibly damaging 0.54
R2278:Kcnk18 UTSW 19 59,235,494 (GRCm38) missense probably damaging 1.00
R3036:Kcnk18 UTSW 19 59,235,062 (GRCm38) missense probably benign 0.38
R4478:Kcnk18 UTSW 19 59,235,244 (GRCm38) missense probably damaging 1.00
R4494:Kcnk18 UTSW 19 59,234,831 (GRCm38) missense probably damaging 1.00
R4827:Kcnk18 UTSW 19 59,219,930 (GRCm38) missense probably damaging 0.97
R5393:Kcnk18 UTSW 19 59,219,839 (GRCm38) missense probably damaging 1.00
R6077:Kcnk18 UTSW 19 59,235,314 (GRCm38) missense probably damaging 0.98
R6881:Kcnk18 UTSW 19 59,219,958 (GRCm38) missense probably benign
R9641:Kcnk18 UTSW 19 59,234,834 (GRCm38) missense probably damaging 1.00
Z1176:Kcnk18 UTSW 19 59,234,959 (GRCm38) missense probably benign 0.39
Z1177:Kcnk18 UTSW 19 59,225,479 (GRCm38) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTGTGACACTGACCACCATC -3'
(R):5'- TCCTCTTGTCATGTGTAATGGC -3'

Sequencing Primer
(F):5'- CCATCGGGTTTGGGGACATC -3'
(R):5'- ATGGCCAGGTTCCTGAGG -3'
Posted On 2017-10-10