Incidental Mutation 'R6145:Asmt'
ID488853
Institutional Source Beutler Lab
Gene Symbol Asmt
Ensembl Gene ENSMUSG00000093806
Gene Nameacetylserotonin O-methyltransferase
SynonymsHiomt
MMRRC Submission 044292-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6145 (G1)
Quality Score221.009
Status Not validated
ChromosomeX
Chromosomal Location170672644-170678054 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 170674663 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 101 (V101I)
Ref Sequence ENSEMBL: ENSMUSP00000137135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178693]
Predicted Effect probably damaging
Transcript: ENSMUST00000178693
AA Change: V101I

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137135
Gene: ENSMUSG00000093806
AA Change: V101I

DomainStartEndE-ValueType
Pfam:Dimerisation2 17 106 1.1e-29 PFAM
Pfam:Methyltransf_2 111 343 2.8e-82 PFAM
Pfam:Methyltransf_11 190 292 2.8e-8 PFAM
low complexity region 351 371 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the methyltransferase superfamily and is located in the pseudoautosomal region (PAR) of the X and Y chromosomes. The encoded enzyme catalyzes the final reaction in the synthesis of melatonin and is abundant in the pineal gland. Two amino acid substitutions (R78G and R242C) are present in the encoded protein derived from the reference strain, C57BL/6J, and this protein shows low enzyme activity relative to the protein derived from other strains. [provided by RefSeq, May 2015]
PHENOTYPE: Pineal melatonin synthesis requires enzymes encoded by Asmt and Aanat. C57BL/6, BALB/c, AKR/J, NZB/Bl, IS/Cam, and CAST/Ei carry the a allele of Asmt and lack melatonin. SK/Cam, SF/Cam, PERU, and FDS carry the b allele and have normal melatonin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 86,052,942 probably null Het
4930402H24Rik T C 2: 130,778,473 I247V probably benign Het
Abca8b A G 11: 109,973,808 V316A probably benign Het
Acad10 A T 5: 121,622,033 V999D probably damaging Het
Acot8 A G 2: 164,803,065 V66A probably benign Het
Ankrd11 T C 8: 122,892,661 H1484R probably damaging Het
Anxa6 A G 11: 54,994,904 F405S probably damaging Het
Atp1a2 C T 1: 172,287,238 V327I probably damaging Het
Brdt A G 5: 107,377,999 E906G possibly damaging Het
Cacna1g A T 11: 94,462,261 C313S probably damaging Het
Camk2d T C 3: 126,805,858 I329T probably benign Het
Cavin4 A T 4: 48,663,794 H58L probably damaging Het
Ccdc78 C A 17: 25,789,065 P317T probably benign Het
Cdc16 T G 8: 13,767,573 Y295D possibly damaging Het
Cdyl2 T A 8: 116,594,978 N270I probably damaging Het
Cfap221 T A 1: 119,984,816 I114F possibly damaging Het
Dmxl1 A G 18: 49,912,766 E2414G possibly damaging Het
Dnah1 C A 14: 31,300,970 R1070L probably benign Het
Dnah14 T C 1: 181,666,417 S1713P probably benign Het
Dock10 C A 1: 80,575,904 G602* probably null Het
Ep400 A T 5: 110,756,703 V10D possibly damaging Het
Epas1 T C 17: 86,829,429 C807R probably benign Het
Esrrb C T 12: 86,505,899 P200L probably benign Het
Fbxw26 T C 9: 109,732,623 I168V probably benign Het
Fsip2 A T 2: 82,993,768 H6615L possibly damaging Het
Galk2 A T 2: 125,946,842 Q272L possibly damaging Het
Gas7 A C 11: 67,629,612 T43P probably damaging Het
Gm5134 A T 10: 75,995,839 I371F probably damaging Het
Gpr31b C T 17: 13,051,379 R301Q possibly damaging Het
Grk1 T A 8: 13,405,765 Y216* probably null Het
Grm5 T A 7: 88,026,601 M441K probably damaging Het
Heatr6 A G 11: 83,766,136 E408G probably damaging Het
Hoxc9 G T 15: 102,983,959 K201N probably damaging Het
Igsf10 T A 3: 59,331,656 Y368F possibly damaging Het
Il2ra A T 2: 11,680,246 D131V probably damaging Het
Imp4 A G 1: 34,440,096 E19G probably benign Het
Kcnk18 T C 19: 59,235,607 *395Q probably null Het
Kdm6b A T 11: 69,405,026 L805Q unknown Het
Lgr4 T A 2: 110,007,243 L427* probably null Het
Myt1l G A 12: 29,832,381 S525N unknown Het
Nasp G A 4: 116,611,077 T237I probably benign Het
Nell2 G T 15: 95,473,561 Q98K probably damaging Het
Nfasc C T 1: 132,634,717 G107R probably damaging Het
Nsun4 A G 4: 116,040,206 S203P probably damaging Het
Olfr24 T G 9: 18,755,569 D22A probably benign Het
Olfr855 T C 9: 19,584,888 V117A probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pde10a T C 17: 8,929,117 V366A probably damaging Het
Pdxk T A 10: 78,443,791 D250V probably benign Het
Pih1d1 T A 7: 45,159,044 I179N probably damaging Het
Plaa T A 4: 94,583,992 I294F probably damaging Het
Pmel C A 10: 128,715,935 P213T probably damaging Het
Pom121l2 A T 13: 21,982,302 R248* probably null Het
Pou2f1 T C 1: 165,875,433 probably benign Het
Ppm1j G A 3: 104,781,379 R98H probably damaging Het
Prkdc C T 16: 15,772,073 P2600L probably damaging Het
Prom1 T C 5: 44,029,649 N422S probably benign Het
Pspn C T 17: 56,999,467 C154Y probably damaging Het
Ptdss1 T C 13: 66,972,637 probably null Het
Rapgef1 A G 2: 29,736,666 Y993C probably damaging Het
Scrn2 A C 11: 97,032,853 T219P probably benign Het
Sec23ip T G 7: 128,778,484 S874R probably damaging Het
Sept4 G A 11: 87,585,246 probably null Het
Slc15a3 C T 19: 10,857,251 L499F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sra1 A G 18: 36,667,575 M193T probably damaging Het
Srsf4 G T 4: 131,900,294 probably benign Het
Syne1 T C 10: 5,052,750 D8055G probably damaging Het
Syne4 T A 7: 30,316,563 probably null Het
Tbc1d24 C A 17: 24,208,229 G253V probably damaging Het
Tbck T A 3: 132,732,215 I467N probably damaging Het
Tln1 T A 4: 43,538,030 M1857L possibly damaging Het
Ttll2 T C 17: 7,351,632 R299G probably benign Het
Ugt2b36 T G 5: 87,066,213 E524A probably benign Het
Vmn2r124 C T 17: 18,062,851 T269I probably benign Het
Vmn2r4 A G 3: 64,406,943 F206L probably benign Het
Zfp346 A G 13: 55,115,574 K156R probably damaging Het
Other mutations in Asmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1634:Asmt UTSW X 170675829 missense probably damaging 1.00
R1809:Asmt UTSW X 170675745 splice site probably benign
R1994:Asmt UTSW X 170675789 missense possibly damaging 0.83
R4454:Asmt UTSW X 170672721 missense probably benign 0.01
R4546:Asmt UTSW X 170676495 critical splice donor site probably null
R4567:Asmt UTSW X 170676526 intron probably null
R4889:Asmt UTSW X 170677029 missense possibly damaging 0.84
R5601:Asmt UTSW X 170676392 missense probably damaging 0.98
R5687:Asmt UTSW X 170678016 missense unknown
R6151:Asmt UTSW X 170676467 missense possibly damaging 0.92
R6582:Asmt UTSW X 170675031 critical splice donor site probably null
R6752:Asmt UTSW X 170676361 missense probably benign 0.02
R7737:Asmt UTSW X 170676440 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGACATCACCATTGTCCCGC -3'
(R):5'- CTTCACTAAGCTGAGGGTGG -3'

Sequencing Primer
(F):5'- GACTTCCTGTCCCCGATGACG -3'
(R):5'- CTAAGCTGAGGGTGGTGGGC -3'
Posted On2017-10-10