Mutagenetix > Incidental Mutation

Incidental Mutation 'R6146:Depdc5'

488869

Institutional Source

Beutler Lab

Gene Symbol

Depdc5

Ensembl Gene

ENSMUSG00000037426

Gene Name

DEP domain containing 5

Synonyms

MMRRC Submission

044293-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6146 (G1)

Quality Score

200.009

Status

Not validated

Chromosome

Chromosomal Location

32863701-32994236 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 32968731 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 569 (E569G)

Ref Sequence

ENSEMBL: ENSMUSP00000120120 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000124780] [ENSMUST00000130461]

AlphaFold

P61460

Predicted Effect

probably benign
Transcript: ENSMUST00000087897
AA Change: E1216G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: E1216G

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	2.3e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	826	836	N/A	INTRINSIC
low complexity region	994	1006	N/A	INTRINSIC
low complexity region	1159	1175	N/A	INTRINSIC
DEP	1184	1259	2.49e-15	SMART
low complexity region	1322	1335	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119705
AA Change: E1207G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: E1207G

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3e-117	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1150	1166	N/A	INTRINSIC
DEP	1175	1250	2.49e-15	SMART
low complexity region	1313	1326	N/A	INTRINSIC
low complexity region	1511	1525	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120902
AA Change: E1185G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: E1185G

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1128	1144	N/A	INTRINSIC
DEP	1153	1228	2.49e-15	SMART
low complexity region	1291	1304	N/A	INTRINSIC
low complexity region	1489	1503	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124780
AA Change: E569G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000120120
Gene: ENSMUSG00000037426
AA Change: E569G

Domain	Start	End	E-Value	Type
low complexity region	179	189	N/A	INTRINSIC
low complexity region	347	359	N/A	INTRINSIC
SCOP:d1fsha_	519	586	1e-13	SMART
Blast:DEP	537	589	2e-24	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127560

Predicted Effect

probably benign
Transcript: ENSMUST00000130461

SMART Domains

Protein: ENSMUSP00000118681
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
low complexity region	70	82	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000137169
AA Change: E591G

SMART Domains

Protein: ENSMUSP00000121089
Gene: ENSMUSG00000037426
AA Change: E591G

Domain	Start	End	E-Value	Type
low complexity region	54	65	N/A	INTRINSIC
low complexity region	88	97	N/A	INTRINSIC
low complexity region	224	234	N/A	INTRINSIC
low complexity region	392	404	N/A	INTRINSIC
low complexity region	535	551	N/A	INTRINSIC
DEP	560	635	2.49e-15	SMART
low complexity region	698	711	N/A	INTRINSIC
low complexity region	896	910	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	A	G	5: 8,896,587	E29G	probably benign	Het
Abi3bp	T	C	16: 56,671,265	S552P	probably damaging	Het
Adgrg7	A	G	16: 56,773,466	I129T	probably benign	Het
Adhfe1	A	G	1: 9,553,718	N148S	probably damaging	Het
AI182371	A	G	2: 35,097,971	Y77H	probably damaging	Het
Aldh5a1	C	T	13: 24,919,678		probably null	Het
Ankrd2	A	G	19: 42,040,105	T67A	possibly damaging	Het
Anln	A	T	9: 22,376,308	C232*	probably null	Het
C330027C09Rik	A	T	16: 48,994,329	K18*	probably null	Het
Cchcr1	A	G	17: 35,528,578	D587G	possibly damaging	Het
Cgn	G	T	3: 94,767,125	Q901K	possibly damaging	Het
Cluh	G	T	11: 74,667,228		probably null	Het
Crebbp	G	A	16: 4,084,623	Q2213*	probably null	Het
Cyp2d22	T	A	15: 82,373,835		probably null	Het
Dcdc2a	T	C	13: 25,205,457	V456A	probably benign	Het
Dnah5	T	C	15: 28,459,185	F4517L	probably benign	Het
Doc2b	T	C	11: 75,773,595	K317E	probably damaging	Het
Dysf	T	A	6: 84,203,199	D1951E	probably damaging	Het
Epha6	C	A	16: 60,424,835	A334S	possibly damaging	Het
F2rl2	A	C	13: 95,700,641	I65L	probably benign	Het
Fbxw17	A	G	13: 50,432,512	K417E	probably benign	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Fxr2	A	G	11: 69,641,339	M96V	possibly damaging	Het
Kcnj10	C	A	1: 172,369,325	Y135*	probably null	Het
Kidins220	G	A	12: 25,052,813	R1238Q	probably damaging	Het
Krt31	T	C	11: 100,048,230	N255S	probably benign	Het
Lrp2	T	C	2: 69,511,001	D945G	probably benign	Het
Lrrc66	T	C	5: 73,608,089	D537G	probably benign	Het
Ltbp4	T	A	7: 27,319,724	I992F	probably damaging	Het
Lzts1	A	G	8: 69,140,872	S28P	probably benign	Het
Mrc2	C	A	11: 105,325,644	N86K	probably damaging	Het
Mroh6	C	A	15: 75,886,637	A302S	possibly damaging	Het
Muc16	T	A	9: 18,497,797	N198Y	probably damaging	Het
Myo9a	T	C	9: 59,871,229	S1423P	probably benign	Het
Olfr1006	T	A	2: 85,674,594	K186*	probably null	Het
Olfr1124	A	T	2: 87,435,318	D277V	possibly damaging	Het
Olfr1141	A	C	2: 87,753,258	L245R	probably damaging	Het
Olfr1367	A	T	13: 21,346,994	Y22F	possibly damaging	Het
Olfr190	A	G	16: 59,074,714	V122A	probably benign	Het
Olfr477	G	T	7: 107,990,413	G16V	probably damaging	Het
Otogl	G	A	10: 107,777,117		silent	Het
Polg	T	C	7: 79,450,512	M1184V	probably benign	Het
Prl8a8	T	C	13: 27,510,480	Y108C	probably damaging	Het
Proser1	T	A	3: 53,478,119	I474N	probably damaging	Het
Rab44	A	G	17: 29,135,417		probably benign	Het
Rbp1	C	A	9: 98,425,616	D79E	possibly damaging	Het
Rnf213	T	C	11: 119,435,999	V1605A	probably benign	Het
Rps24	A	T	14: 24,490,735		probably null	Het
Setd5	T	C	6: 113,121,812		probably null	Het
Slc38a3	T	C	9: 107,655,029	I435V	probably benign	Het
Slco1a5	T	A	6: 142,234,808	M623L	probably benign	Het
Spaca9	G	A	2: 28,693,781	R64W	probably damaging	Het
Spn	A	G	7: 127,136,307	S343P	possibly damaging	Het
Sptan1	A	G	2: 30,004,523	T1168A	probably benign	Het
Sptbn4	A	T	7: 27,364,587	L2138*	probably null	Het
Tg	T	A	15: 66,673,367		probably null	Het
Tigd5	T	A	15: 75,910,245	L152Q	probably damaging	Het
Tmem163	C	T	1: 127,519,389	V170I	probably benign	Het
Tpr	T	C	1: 150,423,162	C1068R	possibly damaging	Het
Ttc37	A	G	13: 76,185,240	E1536G	probably damaging	Het
Ubr1	A	T	2: 120,893,209	Y1290N	probably damaging	Het
Vmn1r184	T	A	7: 26,267,392	F188I	probably benign	Het
Vmn2r100	G	A	17: 19,522,260	V299I	probably benign	Het
Vmn2r91	T	G	17: 18,136,256	H728Q	probably benign	Het
Vta1	T	C	10: 14,705,352	Y37C	probably damaging	Het
Wbp2	C	A	11: 116,083,902	M35I	probably benign	Het
Zcchc9	G	A	13: 91,805,867	Q90*	probably null	Het

Other mutations in Depdc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Depdc5	APN	5	32967814	splice site	probably null
IGL01019:Depdc5	APN	5	32893401	missense	probably damaging	0.96
IGL01067:Depdc5	APN	5	32899067	splice site	probably null
IGL01405:Depdc5	APN	5	32937689	missense	possibly damaging	0.90
IGL01577:Depdc5	APN	5	32955897	missense	possibly damaging	0.49
IGL01633:Depdc5	APN	5	32924200	missense	probably damaging	1.00
IGL01998:Depdc5	APN	5	32945151	splice site	probably benign
IGL02025:Depdc5	APN	5	32946632	critical splice acceptor site	probably null
IGL02167:Depdc5	APN	5	32903801	missense	probably damaging	1.00
IGL02537:Depdc5	APN	5	32967787	missense	probably damaging	1.00
IGL02812:Depdc5	APN	5	32893368	splice site	probably benign
IGL03001:Depdc5	APN	5	32945090	missense	possibly damaging	0.74
IGL03253:Depdc5	APN	5	32868813	unclassified	probably benign
alligator	UTSW	5	32964507	splice site	probably null
lagarto	UTSW	5	32979508	missense	probably damaging	1.00
sauros	UTSW	5	32986966	missense	possibly damaging	0.92
IGL02988:Depdc5	UTSW	5	32956167	splice site	probably null
R0038:Depdc5	UTSW	5	32868853	missense	probably benign	0.01
R0038:Depdc5	UTSW	5	32868853	missense	probably benign	0.01
R0153:Depdc5	UTSW	5	32933937	splice site	probably benign
R0179:Depdc5	UTSW	5	32901574	unclassified	probably benign
R0212:Depdc5	UTSW	5	32912242	missense	probably benign	0.00
R0239:Depdc5	UTSW	5	32943240	missense	probably damaging	1.00
R0239:Depdc5	UTSW	5	32943240	missense	probably damaging	1.00
R0302:Depdc5	UTSW	5	32904546	critical splice donor site	probably benign
R0511:Depdc5	UTSW	5	32945028	nonsense	probably null
R0677:Depdc5	UTSW	5	32901470	missense	probably damaging	1.00
R0884:Depdc5	UTSW	5	32917978	missense	possibly damaging	0.94
R0973:Depdc5	UTSW	5	32986966	missense	possibly damaging	0.92
R1314:Depdc5	UTSW	5	32877074	missense	probably damaging	1.00
R1611:Depdc5	UTSW	5	32990953	missense	probably damaging	1.00
R1687:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R1748:Depdc5	UTSW	5	32917942	missense	probably benign	0.24
R1903:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R1956:Depdc5	UTSW	5	32903831	missense	probably damaging	1.00
R1997:Depdc5	UTSW	5	32901906	critical splice donor site	probably null
R2079:Depdc5	UTSW	5	32946674	missense	possibly damaging	0.75
R2131:Depdc5	UTSW	5	32990781	nonsense	probably null
R2291:Depdc5	UTSW	5	32979402	missense	probably damaging	1.00
R2422:Depdc5	UTSW	5	32991035	missense	probably damaging	1.00
R2851:Depdc5	UTSW	5	32924171	missense	probably damaging	0.96
R2852:Depdc5	UTSW	5	32924171	missense	probably damaging	0.96
R2937:Depdc5	UTSW	5	32901621	splice site	probably null
R2938:Depdc5	UTSW	5	32901621	splice site	probably null
R2974:Depdc5	UTSW	5	32934017	critical splice donor site	probably null
R3884:Depdc5	UTSW	5	32944077	missense	probably damaging	1.00
R3967:Depdc5	UTSW	5	32944115	nonsense	probably null
R4118:Depdc5	UTSW	5	32964635	missense	probably damaging	1.00
R4197:Depdc5	UTSW	5	32991203	missense	possibly damaging	0.93
R4407:Depdc5	UTSW	5	32904534	critical splice donor site	probably null
R4534:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R4535:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R4538:Depdc5	UTSW	5	32983946	missense	probably damaging	1.00
R4613:Depdc5	UTSW	5	32975446	missense	probably damaging	1.00
R4736:Depdc5	UTSW	5	32975322	missense	probably benign
R4738:Depdc5	UTSW	5	32975322	missense	probably benign
R4765:Depdc5	UTSW	5	32937635	missense	probably damaging	1.00
R5021:Depdc5	UTSW	5	32979414	missense	probably damaging	1.00
R5259:Depdc5	UTSW	5	32938291	missense	probably damaging	1.00
R5261:Depdc5	UTSW	5	32938291	missense	probably damaging	1.00
R5541:Depdc5	UTSW	5	32864629	utr 5 prime	probably benign
R5594:Depdc5	UTSW	5	32901490	missense	possibly damaging	0.46
R5929:Depdc5	UTSW	5	32975506	nonsense	probably null
R6132:Depdc5	UTSW	5	32910467	missense	probably damaging	0.99
R6336:Depdc5	UTSW	5	32964507	splice site	probably null
R6468:Depdc5	UTSW	5	32912231	missense	probably benign	0.02
R6911:Depdc5	UTSW	5	32924192	missense	probably damaging	1.00
R6969:Depdc5	UTSW	5	32983860	missense	probably damaging	1.00
R7002:Depdc5	UTSW	5	32877158	splice site	probably null
R7066:Depdc5	UTSW	5	32901848	missense	probably benign	0.08
R7231:Depdc5	UTSW	5	32901865	missense	possibly damaging	0.92
R7264:Depdc5	UTSW	5	32967745	missense	probably benign
R7302:Depdc5	UTSW	5	32979508	missense	probably damaging	1.00
R7386:Depdc5	UTSW	5	32927936	missense	probably benign
R7564:Depdc5	UTSW	5	32901510	missense	probably damaging	1.00
R7636:Depdc5	UTSW	5	32917983	missense	probably benign
R7795:Depdc5	UTSW	5	32944103	missense	probably damaging	1.00
R7845:Depdc5	UTSW	5	32903915	splice site	probably null
R8013:Depdc5	UTSW	5	32973842	missense	probably benign	0.01
R8037:Depdc5	UTSW	5	32959348	critical splice donor site	probably null
R8038:Depdc5	UTSW	5	32959348	critical splice donor site	probably null
R8065:Depdc5	UTSW	5	32895908	missense	possibly damaging	0.89
R8067:Depdc5	UTSW	5	32895908	missense	possibly damaging	0.89
R8108:Depdc5	UTSW	5	32945049	missense	probably benign	0.01
R8112:Depdc5	UTSW	5	32968706	missense	possibly damaging	0.67
R8213:Depdc5	UTSW	5	32937637	missense	probably damaging	1.00
R8382:Depdc5	UTSW	5	32927898	missense	probably benign	0.00
R8680:Depdc5	UTSW	5	32944038	missense	possibly damaging	0.48
R8743:Depdc5	UTSW	5	32924243	missense	probably benign	0.10
R8754:Depdc5	UTSW	5	32979537	missense	probably benign	0.00
R9157:Depdc5	UTSW	5	32945108	missense	probably damaging	0.98
R9364:Depdc5	UTSW	5	32964732	missense	probably benign
R9441:Depdc5	UTSW	5	32937698	missense	probably benign	0.03
R9450:Depdc5	UTSW	5	32934010	missense	probably benign
R9459:Depdc5	UTSW	5	32990773	missense	probably damaging	0.99
R9554:Depdc5	UTSW	5	32964732	missense	probably benign
R9569:Depdc5	UTSW	5	32867977	missense	probably damaging	0.98
R9647:Depdc5	UTSW	5	32924223	missense	possibly damaging	0.94
R9688:Depdc5	UTSW	5	32897932	nonsense	probably null
X0027:Depdc5	UTSW	5	32904292	missense	probably damaging	1.00
Z1176:Depdc5	UTSW	5	32943282	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- GTTCTTCTATCATGCCATGGGG -3'
(R):5'- TATTCAAAGGCAGACCCAGC -3'

Sequencing Primer
(F):5'- GGAGTTATATATAAACCCTCCCTTGG -3'
(R):5'- CAACTCCAGATACGTATTATGTCTGG -3'

Posted On

2017-10-10